CRISPR

CRISPR4-nrl

ID

ZDB-CRISPR-221101-1

Name

CRISPR4-nrl

Previous Names

None

Target

nrl (1)

Sequence

5' - GTCACTCAGCGTGGGCGATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "GGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
hzu16	nrl

Expression

Gene expression in Wild Types + CRISPR4-nrl

No data available

Phenotype

Phenotype resulting from CRISPR4-nrl

No data available

Phenotype of all Fish created by or utilizing CRISPR4-nrl

Phenotype	Fish	Conditions	Figures
eye ab2-gnat2 labeling increased amount, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 6 from Liu et al., 2022
eye opn1mw4 expression increased amount, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 6 from Liu et al., 2022
eye ab1-gnat1 labeling decreased amount, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 6 from Liu et al., 2022
photoreceptor outer segment layer decreased thickness, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 1 from Liu et al., 2022
eye nrl expression increased amount, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 1 , Fig 8 from Liu et al., 2022
short double cone cell cone photoreceptor outer segment increased amount, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 6 from Liu et al., 2022
retinal pigmented epithelium apoptotic process increased process quality, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 10 from Liu et al., 2022
eye ab1-gnb1 labeling decreased amount, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 6 from Liu et al., 2022
eye nr2e3 expression decreased amount, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 8 from Liu et al., 2022
short double cone cell cone photoreceptor outer segment mislocalised, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 6 from Liu et al., 2022
eye opn1mw1 expression increased amount, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 6 from Liu et al., 2022
retinal photoreceptor layer cell population proliferation increased process quality, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 10 from Liu et al., 2022
retinal rod cell rod photoreceptor outer segment decreased amount, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 2 from Liu et al., 2022
retinal rod cell decreased amount, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 1 from Liu et al., 2022
retinal rod cell apoptotic process increased process quality, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 10 from Liu et al., 2022
eye opn1lw2 expression increased amount, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 6 from Liu et al., 2022
eye opn1mw2 expression increased amount, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 6 from Liu et al., 2022
eye rho expression decreased amount, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 6 from Liu et al., 2022
retinal ganglion cell layer Ab22-gfap labeling increased distribution, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 10 from Liu et al., 2022
retinal inner nuclear layer apoptotic process increased process quality, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 10 from Liu et al., 2022
retinal cone cell apoptotic process increased process quality, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 10 from Liu et al., 2022
eye mafba expression decreased amount, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 8 from Liu et al., 2022
retinal photoreceptor layer Ab17-pcna labeling increased distribution, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 10 from Liu et al., 2022
eye opn1mw3 expression increased amount, abnormal	nrl^hzu16/hzu16	standard conditions	Fig 6 from Liu et al., 2022
retinal rod cell ab1-gnat1 labeling decreased distribution, abnormal	nrl^hzu16/hzu16; kj2Tg	standard conditions	Fig 3 from Liu et al., 2022
retinal rod cell EGFP expression decreased distribution, abnormal	nrl^hzu16/hzu16; kj2Tg	standard conditions	Fig 3 , Fig 4 , Fig 7 , Fig 8 from Liu et al., 2022
retinal rod cell decreased amount, abnormal	nrl^hzu16/hzu16; kj2Tg	standard conditions	Fig 3 , Fig 4 , Fig 8 from Liu et al., 2022
ciliary marginal zone retinal rod cell absence of anatomical entity, abnormal	nrl^hzu16/hzu16; kj2Tg	standard conditions	Fig 4 from Liu et al., 2022
short double cone cell cone photoreceptor outer segment opn1mw1 expression mislocalised, abnormal	nrl^hzu16/hzu16; kj2Tg	standard conditions	Fig 7 from Liu et al., 2022
retinal outer nuclear layer retinal rod cell decreased thickness, abnormal	nrl^hzu16/hzu16; kj2Tg	standard conditions	Fig 4 from Liu et al., 2022
retinal rod cell EGFP expression absent, abnormal	nrl^hzu16/hzu16; kj2Tg	standard conditions	Fig 3 from Liu et al., 2022
retinal rod cell rod photoreceptor outer segment opn1mw1 expression mislocalised, abnormal	nrl^hzu16/hzu16; kj2Tg	standard conditions	Fig 7 from Liu et al., 2022
retinal rod cell EGFP expression decreased distribution, abnormal	mafba^hzu17/+; nrl^hzu16/hzu16; kj2Tg	standard conditions	Fig 8 from Liu et al., 2022
retinal rod cell decreased amount, abnormal	mafba^hzu17/+; nrl^hzu16/hzu16; kj2Tg	standard conditions	Fig 8 from Liu et al., 2022
retinal rod cell absence of anatomical entity, abnormal	mafba^hzu17/hzu17; nrl^hzu16/hzu16; kj2Tg	standard conditions	Fig 8 from Liu et al., 2022
retinal rod cell EGFP expression absent, abnormal	mafba^hzu17/hzu17; nrl^hzu16/hzu16; kj2Tg	standard conditions	Fig 8 from Liu et al., 2022
whole organism dead, abnormal	mafba^hzu17/hzu17; nrl^hzu16/hzu16; kj2Tg	standard conditions	text only from Liu et al., 2022

Citations