CRISPR

CRISPR4-nrl

ID
ZDB-CRISPR-221101-1
Name
CRISPR4-nrl
Previous Names
None
Target
Sequence
5' - GTCACTCAGCGTGGGCGATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hzu16 nrl
zko2875A nrl
Expression
Gene expression in Wild Types + CRISPR4-nrl
No data available
Phenotype
Phenotype resulting from CRISPR4-nrl
No data available
Phenotype of all Fish created by or utilizing CRISPR4-nrl
Phenotype Fish Conditions Figures
eye ab2-gnat2 labeling increased amount, abnormal nrlhzu16/hzu16 standard conditions Fig 6 with image from Liu et al., 2022
eye opn1mw4 expression increased amount, abnormal nrlhzu16/hzu16 standard conditions Fig 6 with image from Liu et al., 2022
eye ab1-gnat1 labeling decreased amount, abnormal nrlhzu16/hzu16 standard conditions Fig 6 with image from Liu et al., 2022
photoreceptor outer segment layer decreased thickness, abnormal nrlhzu16/hzu16 standard conditions Fig 1 with image from Liu et al., 2022
eye nrl expression increased amount, abnormal nrlhzu16/hzu16 standard conditions Fig 1 with imageFig 8 with image from Liu et al., 2022
short double cone cell cone photoreceptor outer segment increased amount, abnormal nrlhzu16/hzu16 standard conditions Fig 6 with image from Liu et al., 2022
retinal pigmented epithelium apoptotic process increased process quality, abnormal nrlhzu16/hzu16 standard conditions Fig 10 with image from Liu et al., 2022
eye ab1-gnb1 labeling decreased amount, abnormal nrlhzu16/hzu16 standard conditions Fig 6 with image from Liu et al., 2022
eye nr2e3 expression decreased amount, abnormal nrlhzu16/hzu16 standard conditions Fig 8 with image from Liu et al., 2022
short double cone cell cone photoreceptor outer segment mislocalised, abnormal nrlhzu16/hzu16 standard conditions Fig 6 with image from Liu et al., 2022
eye opn1mw1 expression increased amount, abnormal nrlhzu16/hzu16 standard conditions Fig 6 with image from Liu et al., 2022
retinal photoreceptor layer cell population proliferation increased process quality, abnormal nrlhzu16/hzu16 standard conditions Fig 10 with image from Liu et al., 2022
retinal rod cell rod photoreceptor outer segment decreased amount, abnormal nrlhzu16/hzu16 standard conditions Fig 2 with image from Liu et al., 2022
retinal rod cell decreased amount, abnormal nrlhzu16/hzu16 standard conditions Fig 1 with image from Liu et al., 2022
retinal rod cell apoptotic process increased process quality, abnormal nrlhzu16/hzu16 standard conditions Fig 10 with image from Liu et al., 2022
eye opn1lw2 expression increased amount, abnormal nrlhzu16/hzu16 standard conditions Fig 6 with image from Liu et al., 2022
eye opn1mw2 expression increased amount, abnormal nrlhzu16/hzu16 standard conditions Fig 6 with image from Liu et al., 2022
eye rho expression decreased amount, abnormal nrlhzu16/hzu16 standard conditions Fig 6 with image from Liu et al., 2022
retinal ganglion cell layer Ab22-gfap labeling increased distribution, abnormal nrlhzu16/hzu16 standard conditions Fig 10 with image from Liu et al., 2022
retinal inner nuclear layer apoptotic process increased process quality, abnormal nrlhzu16/hzu16 standard conditions Fig 10 with image from Liu et al., 2022
retinal cone cell apoptotic process increased process quality, abnormal nrlhzu16/hzu16 standard conditions Fig 10 with image from Liu et al., 2022
eye mafba expression decreased amount, abnormal nrlhzu16/hzu16 standard conditions Fig 8 with image from Liu et al., 2022
retinal photoreceptor layer Ab17-pcna labeling increased distribution, abnormal nrlhzu16/hzu16 standard conditions Fig 10 with image from Liu et al., 2022
eye opn1mw3 expression increased amount, abnormal nrlhzu16/hzu16 standard conditions Fig 6 with image from Liu et al., 2022
retinal rod cell ab1-gnat1 labeling decreased distribution, abnormal nrlhzu16/hzu16; kj2Tg standard conditions Fig 3 with image from Liu et al., 2022
retinal rod cell EGFP expression decreased distribution, abnormal nrlhzu16/hzu16; kj2Tg standard conditions Fig 3 with imageFig 4 with imageFig 7 with imageFig 8 with image from Liu et al., 2022
retinal rod cell decreased amount, abnormal nrlhzu16/hzu16; kj2Tg standard conditions Fig 3 with imageFig 4 with imageFig 8 with image from Liu et al., 2022
ciliary marginal zone retinal rod cell absence of anatomical entity, abnormal nrlhzu16/hzu16; kj2Tg standard conditions Fig 4 with image from Liu et al., 2022
short double cone cell cone photoreceptor outer segment opn1mw1 expression mislocalised, abnormal nrlhzu16/hzu16; kj2Tg standard conditions Fig 7 with image from Liu et al., 2022
retinal outer nuclear layer retinal rod cell decreased thickness, abnormal nrlhzu16/hzu16; kj2Tg standard conditions Fig 4 with image from Liu et al., 2022
retinal rod cell EGFP expression absent, abnormal nrlhzu16/hzu16; kj2Tg standard conditions Fig 3 with image from Liu et al., 2022
retinal rod cell rod photoreceptor outer segment opn1mw1 expression mislocalised, abnormal nrlhzu16/hzu16; kj2Tg standard conditions Fig 7 with image from Liu et al., 2022
retinal rod cell EGFP expression decreased distribution, abnormal mafbahzu17/+; nrlhzu16/hzu16; kj2Tg standard conditions Fig 8 with image from Liu et al., 2022
retinal rod cell decreased amount, abnormal mafbahzu17/+; nrlhzu16/hzu16; kj2Tg standard conditions Fig 8 with image from Liu et al., 2022
retinal rod cell absence of anatomical entity, abnormal mafbahzu17/hzu17; nrlhzu16/hzu16; kj2Tg standard conditions Fig 8 with image from Liu et al., 2022
retinal rod cell EGFP expression absent, abnormal mafbahzu17/hzu17; nrlhzu16/hzu16; kj2Tg standard conditions Fig 8 with image from Liu et al., 2022
whole organism dead, abnormal mafbahzu17/hzu17; nrlhzu16/hzu16; kj2Tg standard conditions text only from Liu et al., 2022
Citations