CRISPR

CRISPR4-egfra

ID
ZDB-CRISPR-220815-4
Name
CRISPR4-egfra
Previous Names
None
Target
Sequence
5' - ACCCAAACACACACCAGCTCGCGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
umo21 egfra
Expression
Gene expression in Wild Types + CRISPR4-egfra
No data available
Phenotype
Phenotype resulting from CRISPR4-egfra
No data available
Phenotype of all Fish created by or utilizing CRISPR4-egfra
Phenotype Fish Conditions Figures
ovarian follicle degenerate, abnormal egfraumo21/umo21 (AB) standard conditions FIGURE 9 with image from Song et al., 2022
ovarian follicle ccl34b.8 expression increased amount, abnormal egfraumo21/umo21 (AB) standard conditions FIGURE 7 with image from Song et al., 2022
female organism urogenital papilla absent, abnormal egfraumo21/umo21 (AB) standard conditions FIGURE 10 with image from Song et al., 2022
female organism male gonad development increased occurrence, abnormal egfraumo21/umo21 (AB) standard conditions FIGURE 10 with image from Song et al., 2022
caudal fin dark yellow brown, abnormal egfraumo21/umo21 (AB) standard conditions FIGURE 10 with image from Song et al., 2022
ovarian follicle ccl35.2 expression increased amount, abnormal egfraumo21/umo21 (AB) standard conditions FIGURE 7 with image from Song et al., 2022
female organism spermatogenesis increased occurrence, abnormal egfraumo21/umo21 (AB) standard conditions FIGURE 9 with imageFIGURE 10 with image from Song et al., 2022
ovarian follicle development arrested, abnormal egfraumo21/umo21 (AB) standard conditions FIGURE 5 with imageFIGURE 6 with image from Song et al., 2022
ovary translucent, abnormal egfraumo21/umo21 (AB) standard conditions FIGURE 5 with image from Song et al., 2022
female organism testis present, abnormal egfraumo21/umo21 (AB) standard conditions FIGURE 10 with image from Song et al., 2022
ovarian follicle stage I increased amount, abnormal egfraumo21/umo21 (AB) standard conditions FIGURE 5 with imageFIGURE 6 with image from Song et al., 2022
male organism decreased weight, abnormal egfraumo21/umo21 (AB) standard conditions FIGURE 2 with image from Song et al., 2022
female organism slender, abnormal egfraumo21/umo21 (AB) standard conditions FIGURE 5 with image from Song et al., 2022
ovarian follicle somatic cell ab9-mapk labeling increased amount, abnormal egfraumo21/umo21 (AB) standard conditions FIGURE 7 with image from Song et al., 2022
ovarian follicle ccl34b.1 expression increased amount, abnormal egfraumo21/umo21 (AB) standard conditions FIGURE 7 with image from Song et al., 2022
ovarian follicle ccl25b expression increased amount, abnormal egfraumo21/umo21 (AB) standard conditions FIGURE 7 with image from Song et al., 2022
male organism decreased length, abnormal egfraumo21/umo21 (AB) standard conditions FIGURE 2 with image from Song et al., 2022
ovary fibrotic, abnormal egfraumo21/umo21; inhaumo19/umo19 (AB) standard conditions FIGURE 11 with image from Song et al., 2022
ovarian follicle development arrested, abnormal egfraumo21/umo21; inhaumo19/umo19 (AB) standard conditions FIGURE 11 with image from Song et al., 2022
ovarian follicle stage I increased amount, abnormal egfraumo21/umo21; inhaumo19/umo19 (AB) standard conditions FIGURE 11 with image from Song et al., 2022
Citations