CRISPR

CRISPR1-thoc1

ID
ZDB-CRISPR-210325-1
Name
CRISPR1-thoc1
Previous Names
None
Target
Sequence
5' - GGTGATTAAAACCGGAGAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-thoc1
No data available
Phenotype
Phenotype resulting from CRISPR1-thoc1
Phenotype Fish Figures
neuromast decreased amount, abnormal s356tTg + CRISPR1-thoc1 Fig 3 with imageFig. S8 from Zhang et al., 2020
neuromast has fewer parts of type neuromast hair cell, abnormal s356tTg + CRISPR1-thoc1 Fig 3 with image from Zhang et al., 2020
neuromast hair cell decreased amount, abnormal s356tTg + CRISPR1-thoc1 Fig 3 with imageFig 7 with image from Zhang et al., 2020
neuromast hair cell decreased size, abnormal s356tTg + CRISPR1-thoc1 Fig 5 with image from Zhang et al., 2020
neuromast hair cell deformed, abnormal s356tTg + CRISPR1-thoc1 Fig 5 with image from Zhang et al., 2020
neuromast hair cell morphology, abnormal s356tTg + CRISPR1-thoc1 Fig 5 with image from Zhang et al., 2020
neuromast hair cell shape, abnormal s356tTg + CRISPR1-thoc1 Fig 5 with image from Zhang et al., 2020
neuromast hair cell apoptotic process increased occurrence, abnormal s356tTg + CRISPR1-thoc1 Fig 7 with image from Zhang et al., 2020
neuromast support cell apoptotic, abnormal s356tTg + CRISPR1-thoc1 Fig 5 with image from Zhang et al., 2020
otic vesicle has fewer parts of type hair cell, abnormal s356tTg + CRISPR1-thoc1 Fig. S9 from Zhang et al., 2020
startle response decreased process quality, abnormal zf106Tg + CRISPR1-thoc1 Fig. S11 from Zhang et al., 2020
whole organism casp3a expression increased amount, abnormal s356tTg + CRISPR1-thoc1 Fig 6 with image from Zhang et al., 2020
whole organism baxa expression increased amount, abnormal s356tTg + CRISPR1-thoc1 Fig 6 with image from Zhang et al., 2020
whole organism tp53 expression increased amount, abnormal s356tTg + CRISPR1-thoc1 Fig 6 with image from Zhang et al., 2020
whole organism casp9 expression increased amount, abnormal s356tTg + CRISPR1-thoc1 Fig 6 with image from Zhang et al., 2020
Phenotype of all Fish created by or utilizing CRISPR1-thoc1
Phenotype Fish Conditions Figures
whole organism baxa expression increased amount, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 6 with image from Zhang et al., 2020
neuromast hair cell deformed, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 5 with image from Zhang et al., 2020
neuromast hair cell shape, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 5 with image from Zhang et al., 2020
neuromast hair cell decreased amount, abnormal s356tTg + CRISPR1-thoc1 control Fig 3 with imageFig 7 with image from Zhang et al., 2020
neuromast hair cell morphology, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 5 with image from Zhang et al., 2020
neuromast decreased amount, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 3 with image from Zhang et al., 2020
neuromast has fewer parts of type neuromast hair cell, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 3 with image from Zhang et al., 2020
neuromast hair cell amount, ameliorated s356tTg + CRISPR1-thoc1 chemical treatment: pharmaceutical Fig 7 with image from Zhang et al., 2020
neuromast hair cell apoptotic process increased occurrence, abnormal s356tTg + CRISPR1-thoc1 control Fig 7 with image from Zhang et al., 2020
neuromast hair cell apoptotic process occurrence, ameliorated s356tTg + CRISPR1-thoc1 chemical treatment: pharmaceutical Fig 7 with image from Zhang et al., 2020
whole organism tp53 expression increased amount, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 6 with image from Zhang et al., 2020
otic vesicle has fewer parts of type hair cell, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig. S9 from Zhang et al., 2020
neuromast support cell apoptotic, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 5 with image from Zhang et al., 2020
whole organism casp9 expression increased amount, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 6 with image from Zhang et al., 2020
neuromast hair cell decreased size, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 5 with image from Zhang et al., 2020
whole organism casp3a expression increased amount, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 6 with image from Zhang et al., 2020
neuromast decreased amount, abnormal zf106Tg + CRISPR1-thoc1 standard conditions Fig. S8 from Zhang et al., 2020
startle response decreased process quality, abnormal zf106Tg + CRISPR1-thoc1 standard conditions Fig. S11 from Zhang et al., 2020
Citations