CRISPR

CRISPR1-thoc1

ID
ZDB-CRISPR-210325-1
Name
CRISPR1-thoc1
Previous Names
None
Target
Sequence
5' - GGTGATTAAAACCGGAGAGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-thoc1
Expressed Gene Anatomy Figures
baxa Fig 6 with image from Zhang et al., 2020
casp3a Fig 6 with image from Zhang et al., 2020
casp9 Fig 6 with image from Zhang et al., 2020
tp53 Fig 6 with image from Zhang et al., 2020
Phenotype
Phenotype resulting from CRISPR1-thoc1
Phenotype Fish Figures
neuromast decreased amount, abnormal zf106Tg + CRISPR1-thoc1 Fig 3 with image,  Fig. S8 from Zhang et al., 2020
neuromast has fewer parts of type neuromast hair cell, abnormal s356tTg + CRISPR1-thoc1 Fig 3 with image from Zhang et al., 2020
neuromast hair cell decreased amount, abnormal s356tTg + CRISPR1-thoc1 Fig 3 with image,  Fig 7 with image from Zhang et al., 2020
neuromast hair cell decreased size, abnormal s356tTg + CRISPR1-thoc1 Fig 5 with image from Zhang et al., 2020
neuromast hair cell deformed, abnormal s356tTg + CRISPR1-thoc1 Fig 5 with image from Zhang et al., 2020
neuromast hair cell morphology, abnormal s356tTg + CRISPR1-thoc1 Fig 5 with image from Zhang et al., 2020
neuromast hair cell shape, abnormal s356tTg + CRISPR1-thoc1 Fig 5 with image from Zhang et al., 2020
neuromast hair cell apoptotic process increased occurrence, abnormal s356tTg + CRISPR1-thoc1 Fig 7 with image from Zhang et al., 2020
neuromast support cell apoptotic, abnormal s356tTg + CRISPR1-thoc1 Fig 5 with image from Zhang et al., 2020
otic vesicle has fewer parts of type hair cell, abnormal s356tTg + CRISPR1-thoc1 Fig. S9 from Zhang et al., 2020
startle response decreased process quality, abnormal zf106Tg + CRISPR1-thoc1 Fig. S11 from Zhang et al., 2020
whole organism casp3a expression increased amount, abnormal s356tTg + CRISPR1-thoc1 Fig 6 with image from Zhang et al., 2020
whole organism baxa expression increased amount, abnormal s356tTg + CRISPR1-thoc1 Fig 6 with image from Zhang et al., 2020
whole organism tp53 expression increased amount, abnormal s356tTg + CRISPR1-thoc1 Fig 6 with image from Zhang et al., 2020
whole organism casp9 expression increased amount, abnormal s356tTg + CRISPR1-thoc1 Fig 6 with image from Zhang et al., 2020
Phenotype of all Fish created by or utilizing CRISPR1-thoc1
Phenotype Fish Conditions Figures
whole organism baxa expression increased amount, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 6 with image from Zhang et al., 2020
neuromast hair cell deformed, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 5 with image from Zhang et al., 2020
neuromast hair cell shape, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 5 with image from Zhang et al., 2020
neuromast hair cell decreased amount, abnormal s356tTg + CRISPR1-thoc1 control Fig 3 with image,  Fig 7 with image from Zhang et al., 2020
neuromast hair cell morphology, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 5 with image from Zhang et al., 2020
neuromast decreased amount, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 3 with image from Zhang et al., 2020
neuromast has fewer parts of type neuromast hair cell, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 3 with image from Zhang et al., 2020
neuromast hair cell amount, ameliorated s356tTg + CRISPR1-thoc1 chemical treatment: pharmaceutical Fig 7 with image from Zhang et al., 2020
neuromast hair cell apoptotic process increased occurrence, abnormal s356tTg + CRISPR1-thoc1 control Fig 7 with image from Zhang et al., 2020
neuromast hair cell apoptotic process occurrence, ameliorated s356tTg + CRISPR1-thoc1 chemical treatment: pharmaceutical Fig 7 with image from Zhang et al., 2020
whole organism tp53 expression increased amount, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 6 with image from Zhang et al., 2020
otic vesicle has fewer parts of type hair cell, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig. S9 from Zhang et al., 2020
neuromast support cell apoptotic, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 5 with image from Zhang et al., 2020
whole organism casp9 expression increased amount, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 6 with image from Zhang et al., 2020
neuromast hair cell decreased size, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 5 with image from Zhang et al., 2020
whole organism casp3a expression increased amount, abnormal s356tTg + CRISPR1-thoc1 standard conditions Fig 6 with image from Zhang et al., 2020
neuromast decreased amount, abnormal zf106Tg + CRISPR1-thoc1 standard conditions Fig. S8 from Zhang et al., 2020
startle response decreased process quality, abnormal zf106Tg + CRISPR1-thoc1 standard conditions Fig. S11 from Zhang et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.