header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-161228-1
CRISPR Name: CRISPR1-ar
Target: ar (1)
Source:
Target Sequence:
5' - GGCCATTGAGCCCGAGGTGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-ar No data available
GENOMIC FEATURES CREATED WITH CRISPR1-ar
Genomic Feature Affected Genomic Regions    
ihb1225 ar    
ihb1226 ar    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-ar No data available
PHENOTYPE
Phenotype resulting from CRISPR1-ar
No data available

Phenotype of all Fish created by or utilizing CRISPR1-ar
Phenotype Fish Conditions Figures
female organism increased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 2 from Yu et al., 2018
ovary transparent, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 6 with image from Yu et al., 2018
ovary has fewer parts of type oocyte, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 6 with image from Yu et al., 2018
female organism increased weight, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 2 from Yu et al., 2018
male organism pectoral fin breeding tubercle absent, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 3 with image from Yu et al., 2018
ovarian follicle atretic, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 6 with image from Yu et al., 2018
ovary cyp11a1 expression decreased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 6 with image from Yu et al., 2018
ovary foxl2a expression decreased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 6 with image from Yu et al., 2018
testis cyp19a1a expression increased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 7 from Yu et al., 2018
ovary lacks all parts of type oocyte, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 6 with image from Yu et al., 2018
testis hsd17b1 expression increased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 7 from Yu et al., 2018
testis has fewer parts of type spermatocyte, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 4 with imageFig. S5 with image from Yu et al., 2018
sperm decreased cellular motility, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 4 with image from Yu et al., 2018
male organism decreased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 2 from Yu et al., 2018
testis transparent, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 4 with image from Yu et al., 2018
oocyte stage IV decreased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 6 with imageFig. S4 with image from Yu et al., 2018
female organism has fewer parts of type oocyte, abnormal arihb1225/ihb1225(AB) standard conditions Fig. S4 with image from Yu et al., 2018
ovary lhcgr expression decreased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 6 with image from Yu et al., 2018
spermatogenic cyst decreased size, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 4 with image from Yu et al., 2018
spermatogenesis arrested, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 4 with image from Yu et al., 2018
testis cyp17a1 expression increased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 7 from Yu et al., 2018
ovary decreased size, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 6 with image from Yu et al., 2018
male organism anal fin decreased pigmentation, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 3 with image from Yu et al., 2018
testis ccnd2a expression decreased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 5 with image from Yu et al., 2018
testis has fewer parts of type sperm, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 4 with imageFig. S5 with image from Yu et al., 2018
testis star expression increased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 7 from Yu et al., 2018
germ cell proliferation decreased occurrence, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 5 with image from Yu et al., 2018
ovary cyp19a1a expression decreased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 7 from Yu et al., 2018
testis germ line cell apoptotic, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 5 with image from Yu et al., 2018
visceral fat increased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. S3 with image from Yu et al., 2018
testis has extra parts of type Sertoli cell, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 4 with image from Yu et al., 2018
testis sox9a expression increased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 7 from Yu et al., 2018
ovarian follicle development arrested, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 6 with image from Yu et al., 2018
ovary kitlga expression decreased amount, abnormal arihb1225/ihb1225(AB) control Fig. 6 with image from Yu et al., 2018
female organism female sterile, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 6 with image from Yu et al., 2018
male organism increased weight, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 2 from Yu et al., 2018
testis degenerate, abnormal arihb1225/ihb1225(AB) standard conditions Fig. S5 with image from Yu et al., 2018
testis ar expression decreased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 1 from Yu et al., 2018
spermatogenesis delayed, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 5 with imageFig. S5 with image from Yu et al., 2018
testis has extra parts of type spermatocyte, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 5 with image from Yu et al., 2018
ovary ar expression decreased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 1 from Yu et al., 2018
ovarian follicle degenerate, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 6 with image from Yu et al., 2018
testis amh expression increased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 7 from Yu et al., 2018
fertilization decreased rate, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 6 with image from Yu et al., 2018
male organism proportionality to female organism, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 2 from Yu et al., 2018
ovary hsd17b1 expression decreased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 7 from Yu et al., 2018
testis has extra parts of type spermatogonium, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 4 with imageFig. 5 with imageFig. S5 with image from Yu et al., 2018
testis decreased size, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 4 with image from Yu et al., 2018
ovary cyp17a1 expression decreased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 7 from Yu et al., 2018
spermatogonium increased size, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 4 with image from Yu et al., 2018
male organism male sterile, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 4 with image from Yu et al., 2018
oocyte stage III decreased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 6 with imageFig. S4 with image from Yu et al., 2018
ovary kitlga expression decreased amount, abnormal arihb1225/ihb1225(AB) chemical treatment by injection: 17beta-hydroxy-5alpha-androstan-3-one Fig. 6 with image from Yu et al., 2018
testis gsdf expression increased amount, abnormal arihb1225/ihb1225(AB) standard conditions Fig. 5 with image from Yu et al., 2018
oocyte stage III decreased amount, abnormal arihb1226/ihb1226(AB) standard conditions Fig. S6 with image from Yu et al., 2018
ovarian follicle atretic, abnormal arihb1226/ihb1226(AB) standard conditions Fig. S6 with image from Yu et al., 2018
oocyte stage IV decreased amount, abnormal arihb1226/ihb1226(AB) standard conditions Fig. S6 with image from Yu et al., 2018
ovary lacks all parts of type oocyte, abnormal arihb1226/ihb1226(AB) standard conditions Fig. S6 with image from Yu et al., 2018
ovary transparent, abnormal arihb1226/ihb1226(AB) standard conditions Fig. S6 with image from Yu et al., 2018
female organism increased amount, abnormal arihb1226/ihb1226(AB) standard conditions Fig. 2 from Yu et al., 2018
female organism increased weight, abnormal arihb1226/ihb1226(AB) standard conditions Fig. 2 from Yu et al., 2018
male organism decreased amount, abnormal arihb1226/ihb1226(AB) standard conditions Fig. 2 from Yu et al., 2018
male organism anal fin decreased pigmentation, abnormal arihb1226/ihb1226(AB) standard conditions Fig. 3 with image from Yu et al., 2018
ovary has fewer parts of type oocyte, abnormal arihb1226/ihb1226(AB) standard conditions Fig. S6 with image from Yu et al., 2018
ovary decreased size, abnormal arihb1226/ihb1226(AB) standard conditions Fig. S6 with image from Yu et al., 2018
male organism increased weight, abnormal arihb1226/ihb1226(AB) standard conditions Fig. 2 from Yu et al., 2018
ovarian follicle development arrested, abnormal arihb1226/ihb1226(AB) standard conditions Fig. S6 with image from Yu et al., 2018
female organism female sterile, abnormal arihb1226/ihb1226(AB) standard conditions Fig. S6 with image from Yu et al., 2018
fertilization decreased rate, abnormal arihb1226/ihb1226(AB) standard conditions Fig. S6 with image from Yu et al., 2018
ovarian follicle degenerate, abnormal arihb1226/ihb1226(AB) standard conditions Fig. S6 with image from Yu et al., 2018
male organism proportionality to female organism, abnormal arihb1226/ihb1226(AB) standard conditions Fig. 2 from Yu et al., 2018
male organism pectoral fin breeding tubercle absent, abnormal arihb1226/ihb1226(AB) standard conditions Fig. 3 with image from Yu et al., 2018
OTHER CRISPR1-ar CRISPR PAGESNo links to external sites
CITATIONS (3)