header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-GENE-980526-90

Mapping Details

Gene Name: achaete-scute family bHLH transcription factor 1a
Symbol: ascl1a
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position
ZFIN Gbrowse 4 17,417,111 - 17,419,193
Ensembl 4 17,417,111 - 17,419,193
Vega 4 17,428,135 - 17,430,217
NCBI Map Viewer 4 17,417,129 - 17,418,789
UCSC 4 -
Mapped Clones containing ascl1a
CH211-260P3 Chr: 4 Details
DKEY-264K15 Chr: 4 Details
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
4 109.6 cM zasha Mother of Pearl (MOP) Postlethwait, John H. Data
4 211.74 cR zash-a Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
4 43.07 cM asha Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Genomic Feature t25215 is an allele of ascl1a
Marker Type Chr Distance Publication / Person Comments
z11566 SSLP 4 Pogoda et al., 2006 Pogoda et al. (2006, Development 133(6):1079-1089) mapped piat25215 to LG4 by segregateion linkage analysis.
z27201 SSLP 4 0.5 cM Pogoda et al., 2006 Pogoda et al. (2006, Development 133(6):1079-1089) mapped piat25215 to LG4 by segregateion linkage analysis.
Genomic Feature t25215 is an allele of ascl1a
Chr 18 Herzog et al., 2004
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 978 36.0
Forward Primer CAACTTCTGGACGAGCATGA
Reverse Primer TTCTGAGGGAGGCAAAACC