ZFIN ID: ZDB-ALT-980520-19
Genomic Feature: m806
Synonyms:
Affected Genomic Regions: supt5h
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Driever Lab
Location: Chr 15: 20386193 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Missense (1)
Protein Consequence: Amino Acid Substitution: Val>Asp at position 1012 (1)
FLANKING SEQUENCE (GENOMIC)
ATAGTCCCATGACTCCTGGCGCTCCGTCTCCTGGGGGTTACAACCCTCACACCCCTGGCTCCAACATTGACCAAGCCTCCAATGACTGGGTCACCACAGACATCATGGTGCGTGTGAAAGACACATTCCTTGATGGAGGCGTCATCAATCAGACCGGCATCATCCGCAGTGTCACCGTGAGTCAAGTTTTGAATCTTGTTCATGTGGACATTTATCAGATTCTTTTGGCTACTTAGATTACTTTATGACGGCCAACTGGAATATGCAAATTCATAAACCGCATGTTTCTGCTTGCAGACTCTAGCAGATAATAGTAAACACCCCAGTTTTATGGCTCAGTTTTAGATTTGGCAACTGAGACACTGGTGAACCTTTGATTGATTGATTAAGTGGCTCTTAAAGCCTTTTATTATTAGACGTCACTGCTACATGCTTGTGACGTCTGAAAAAAAATCAACAACTTAATCCTGGTACTTTTTCACAGGGAGGAATGTGCTCTG
T/A
TTTTCTGCAAGACACTGAAAAGGTTGTTAGCATTTCAAGCGAACACTTGGAGCCTGTTACACCAACCAAAAACAATAAGGTACTGATATGTTTATGGAAATTCAAGTTTTTGAGTTATTGCAATTATGTTTATGGTTTTTTTATCGCAAGGTCTTGTGTAATCTCAAGGTGATATCGTCTTGCAGGTGTCCTGTTGTTTTTCAGTTTCTTTCCTTTTCTTAGAGGTGCACAATTCTAAATACAGAATATTTTTATTAAAATTCTCTTATAATTATGAATAGACAGCTAGAAGCATATTTGGTAACACTTTATAATGACTGCCAACTATGAGCCATTTTTTAAGCATTAGCAAATAGTTAATTCATTATCTCTTAAGCATTAACTCTACATTAATAAAGGTAAGTAAGCAGTTACAAATGCTGTATTCTTGACTTATAACCACATTTAAATTCTGCTTAATAATTATACAATCATAATTTGTTGAAAATGTATTTTTCATT
(1)
OTHER m806 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous supt5hm806/m806 supt5h Unknown
supt5hm806/m806 supt5h ♀+/- ♂+/-
Heterozygous supt5hm806/+ supt5h Unknown
Complex supt5hm806/m806; trim33tg234/tg234 supt5h, trim33
la2Tg ; supt5hm806/m806 supt5h
y1Tg ; supt5hm806/m806 supt5h
la401Tg ; la2Tg ; supt5hm806/m806 supt5h

CITATIONS  (11)