ZFIN ID: ZDB-ALT-980413-693
Genomic Feature: ta222a
Synonyms: AA22A (1)
Affected Genomic Regions: dmd
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Nüsslein-Volhard Lab
Location: Chr 1: 11028677 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>T in Exon 4 (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Polypeptide Truncation: Lys>Stop at position 76 (1)
FLANKING SEQUENCE (GENOMIC)
GTCAGGATGAGGGTTGAAAGTAATAGTTTTTCTGCATTTACATCTGTTTTTTAGTATTACATATTATTATAATAGTATAACAATAATTAAAAATCCATGTCATGGCCCCTTTAAGAACTTAATATTTCAGTCGCATCACTGTTTTATTTATCAACACTTTGAAAATTTGCTGAAAACAACTTCAACCAGACATTGTAATTAGATTTTGTTTGTCTGTTTTCAAGCTGTCTCAATGTTTCATTCCATTTTATCATGCAGAGACATTTTTAAGCCAGTGAAATGGATAAGTGTCATTACCTTATCAAGCTGTAAAAAGTGTGCTTCAGCATAATTTTGTCTTGAATTTATTAAAAAAAAGCTCAACCGAAACATTGAAATTTCAGAAGCTGTGAATAGTAAAACAGCCAGCTGAACCAATTAACTCACATTGTTCTTCTGAAGGATCTGCAGGGCCCTGTTAACATTGTTAAGGGAGTGCACTCGAGTGAAGCCACGTTCTT
T/A
AACCTGCAAATGGGGAATATATCAGAAATGAACTTTGAGCATCCATTGCAAATGAATTCAACCATTTATGCACTCATCCTTATCCAAATGCTTTGAAACCTTGGGTATGTCTTTTTTCTTGTTACAAAATAGAGCGAAGAAAGTCTCTCAGAATGTAACCAGAATACAGCAGAGCCAAATAAGGGTATATCGCACCAAATTAATGTTCGGTCATTGTTTACTTATCCTAACTATAATATATAGTCTTTGTGAATAATCAAAGTATTTACATGCTGTTATTTTGCAGAATAGATTGTGTCTGTTGCCATCATTTGAAAGGTACTCTGGACAAAAGAGTCTTCTAAATTATTCATGTAATGTAATGTAATCATTCTTAATGTGAATGAGCTTTTAAATATTTAGACTTAAAAGATTAAACTCCTGGTCAAATACATCATATTACTTCCCAAGACTTTTAAATAAATTACATGAGATGCATCGACCATTTCTGATGATAATGA
(1)
OTHER ta222a PAGES No links to external sites

CITATIONS  (45)