Genomic Feature

m230

ID
ZDB-ALT-980203-553
Name
m230
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Driever Lab
Current Source
Other Pages
Notes
Comment Citation
The zebrafish mutant reggae (reg) was previously described as a model for  ... Benz et al., 2016
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 3: 31741535 (GRCz11) (1) Details
Nucleotide change
A/G
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>C at position 1496 in Exon 8 (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Leu>Pro at position 499 (1)
Sequences
Flanking Sequence
TTTAAAACTAGATTTTTTTTTTTTTATTAGATTTAAAAAAATATATATTGCTAACCCCAGTGTTTTGAATGGTAGTGTACACTCTTTTTAAGTTGTTGCTGTCCCTTAAATAGATGAAGAATGCAGCCCACTTACAGCCAATAAGCATGACGCAAATGGAGAAAATCTTCTCAGGGTTGGTGTTTGGAGAGACATTTCCGAAGCCCACACTGGTCAAGCTACTGAAGGTGAAGTACAATGCAGTAACATATTTGTCCTTGATGGAGGGGCCAGAGAAACTGTTGCTGTCATTGTACTGCTTGCCAATTTGGTCAGCTAAGTTGTCCAGCCAGCCGATCTTCATGCCTCCTATGCGGGCAGAGCTGGTGCGCTCCATATTGCCAATGGCGTACCAGATGCATGCCAGCCAGTGGGCGATGAGAGCAAAGGTGCACATGAGGAGGAAGAGCACCGCCGCTCCATACTCAGAGTAACGGTCCAGTTTTCTCGCTACTCGCACC
A/G GTCGCAGCAGCCGTGCAGTCTTCAGCAGACCAATCAGAGTGGTGGTTTGAGGCTGCAAGGACGAGTTTGAGAGGATTAGTTTGTTTGTACACTCTTATTTTTATTCAGTTGGCATCACTGAAAGAGAAAGGCATGCACTGTATGGCTGTCAACAATCAACATTATCACACTGAGATCGATATTCCAGATCATTCATTGATTGTTCTGAGCGCTTCATCTAAAATTAGAATGTTTACCAATTTGTACGTTTCGTTCTGTTCTGGCTGTTCCTTCAGAGAAAAACGATTGATTAACATTTATTCAGTCTAAGGAAAGCCTCACCTCATCTGAACCGGATCTGAAAATGAGCAGGTCGAAGGGGATGGCAGCAACTATGTCTATGAGGAACCAGCCCTTGAAGTAGTGCTGAGCGATGCGGGCAGGGTTGCTGACCACCTCGTCGTTGTGATTGACGTATGTGGTCCTGAAGTTGATGAGGATGTCGATGATGAACATGACGT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations