ZFIN ID: ZDB-ALT-980203-470
Genomic Feature: n1
Synonyms:
Affected Genomic Regions: noto
Type: Small Deletion (1)
Protocol: spontaneous 
Lab Of Origin: Jowett Lab
Location: Chr 13: 14976378 - 14976379 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 2 bp deleted (1)
Transcript Consequence: Frameshift (1)
FLANKING SEQUENCE (GENOMIC)
TTTCTGGACTACCTCCGGGGGCATGTAGCGCAGAGGGCCATTAGGATATTTGACAATCTCAGCTTGTTACAACTCCATCAGTTAATTGGATCCCTTGTAGAGCCGCTCGTTTGACTCATCTGCCACTTAAAAATACAAAGGCGCGCTGGGGGTCGTTCACACCTCGCGCCCTAGAGCAGGTATAAAAGACCCGCTGCCTCACCAACTTCATTCCACTCCTGATATTAGGGTCGAGAACTTCGAAGGATATCTTTTTTTTTTTTTAGTTGCTTTTTGGACTAAACAGACGCCATGCAGATTCCCGGAAGAGCTTACGAAACTTATGGACAATCAGCACGTCCTTTGCATCAGGACTATGCCACCTCTTCTTCAAAACCGAGCACCGGGAAATCATTCACCATAGACGCTCTGCTCGCGAGGCCTGACCAGGCGGAGATGAGAGAACGAACAAACGCGTACCGGAGCATAACCAACCAAACGTCTGTCTCCAGCTCTGCGCT
CC/-
CGCTTATTTACTCGCAGATGCCACACTTCGCGTACAGCCAAAGCATCATGCAAACTCAGACAGGCTATCCCGTGTTCTGCTATCCGCCCTACAACTTCCAAACAACATGTCGTGGAGCTGTGTACGCACAAGGTATAAAGGCTAGGTTTTAATGAATGTAGCTAAGAATAGAAATTATTTTAATGATACTTCAAATATGATTTCCTAACCAATGCGTTCTTTTGTTTTTCGCACCCACAGATGCAGTACTGGCGAAAGCAGCAGTTCATTCTCATTATAAACACAAATCTGGGAAATCAAAGCGAATGCGTACAAGTTTTACCAACGATCAGCTGTCCAGACTGGAGAAAGAGTTCGCGCGGCAGCAATACATGGTGGGATCTGAACGCTTTCTGTTGGCATCTGCTCTCCAACTCACTGAAGCTCAGGTAAATAAATTACATGGTATGACAAAATTTTAGATTGACTTTTGCTTTCGGTTTAATTCCAAATATGTACAA
Comment Citation
2-bp deletion ZFIN Staff
Two C residues at positions 211 and 212 of the wild-type coding sequence are  ... Talbot et al., 1995
OTHER n1 PAGES No links to external sites

CITATIONS  (80)