Genomic Feature

m129

ID
ZDB-ALT-980203-463
Name
m129
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (2)
Protocol
adult males treated with ENU
Lab of Origin
Driever Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 2: 37372089 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T at position 1519 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Arg>Stop (1)
Sequences
Flanking Sequence
TTAAACGCTAATGCTGTCTAAACTAATGCTCAAGACACAAAAAACCTCAAAAAAGTACTCCAGGGTGTCTTAAAACCTTTAATTTTGACGCCACAAATAAGTTCTTGACTTTTAAATCTAACGTTTGTAATCTTAAAATACACCCCTCACTTTTCTGTTTGTGTAAAAAAAAAATATACACAAAACTAATAGGATGTGTTTATAATGACTCATTTTTGGGTGAGCTATACTTTCAAAGCTGACGCTGCTGAAATGCTACTTGAAGTGGTAAGAGCTCACGACCAAATTACAGGAATGACTAATCAAATGAAGGATTCCTCAAGGTCATAAACAACAGTAAACAGCTCTTCAGGCTCCAGTAAGTCCTCTGTTTAGTTTCACTAACGTCAGGCTAGAGAGAATGACTCATTGCTTCCTCTGCGTCTCGAGTCAAAACATCCAAGAAGACAGATAAAGGAAACGGAGATAACAATGACTCACAAGATCCCAGTCTACATTTC
G/A GAAAAAAGGATGGGCCATGATGTCTGCGAAGCCTGTCTGAGGATGACATCCCAGCCGTTCCTTCGACTCCTACAAAAAAAAGGACTGAATGTCAGTGAGAAGAAATAAGATATATTTTAGTTCTTTTTTGCTCTAATTGTCCAGCTAATAGTTTGCTAACAGTCTAATTTGATATTCATCTGGTCTTTGTATGAATAAAACCGAAAAAGTATTATGTACAATATTAGACTAAAAAAGAGGATCTTCATATTGCTGCTTTTCTGGTGATTTAACTTGCTTCTATTGACCTCATTTGTGAGTTGCTTTGAAAAAAACATCTGCTAAATCAATAAGTGTAAATGCAAAGAGATGAACAGACACACAGAATGATTAACACACAACAGAAGGAAATAAAGTAAAGAATGATTATGGCAGCACTATAACAAGCTCATCTGACGTAAGGACATTAGCATTGATCTGTCTGGTCTGCTTCACCTTGTTGAGGAATCCCTTCAGCACGC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations