ZFIN ID: ZDB-ALT-200304-31
Genomic Feature: a235
Synonyms:
Affected Genomic Regions: astn1 (1)
Type: Indel (1)
Protocol: embryos treated with CRISPR3-astn1CRISPR4-astn1CRISPR2-astn1CRISPR1-astn1
Lab Of Origin: Schier Lab
Location: Chr 2: 34698131 - 34698337 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 2 bp inserted / 207 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
GAAACCATGTGTTTTGCTGCATATATTGTTTAAATGTGTTATTTTGCTGTTGTAAATGTGTAATGTTACTGTTTGACTATTAACATTTACATAATTAATAGTTTAATTCTTATTGGGTTTTGTGTGAAGATTTAGTATTGAGTCAAGTTGACTTACTTACTGAGTACCTCAGTTACTTTTCAAACAAAGTAATTAGAAAAGTAATTTAAATACACATAATTCATTTCTTTATTAAAGTAACTTACCCAACACTGCAACACTGAGAATTAAATTGTAAACCTGGAATATAGTTTTGAAGTATTCCTGCTAGAATGTTTAAATGTTTTTCCTTCTAAATCCTTATAAACTTTCTCTTTTCCTTTATAGGGTGGCATGATCGCTCTTCTGCTGTCCATCCTGTGCTTGGTGTTGATCCTGTACACTCGCAGACGCTGGTGTAAACGTCGCCGGGTTCCTCAACCTCAAAAGAGCGCCAGTGCTGAAGCTGCCAATGAGATCCA
CTACATCCCCTCAGTACTGATGGGTGGACAGGCCCGGGAAAGTCTGAGAAATTCGCGCGGGCAGGGCCACAACTCGAGTGGCACCCTCAGCATCCGAGAGACCCCCATACTGGATGGGTACGAGTATGACATCACTGACCTGCGGCATCACCTGCAGCGGGAGTGTATGAATGGTGGAGAGGACTTCACCAGTCAGGTCACCCGCAC/TT
GCTAGACTCACTTCAGGGGTGCAATGAAAAGGGGGGCATGGACCTCACTCCAGGTGTGTTTTTAAGATTTTAGTAAAAATATAAATTCATATAATTGTCTGTTGAAACATACAAACTATGTATAGGGATGTGCAATAGTTAGGTTCAAGACATCTTGGAGTACTTTTTATTTTTTTATTTAGCACATTTGTGTATGTCAAGCATCAGTTAAGACAACATTAGCACCTGTTAGCTTTAATTGTGGGGACAACGAAATATTTTTGAGGTTTTGTCAGCTAATTTCATCTTCCGGGTTTAAAATAACTTTTAGGATGGGATCCTCACGATTTGTGTTTCATTTTGTGAGCCAACTGACAAACAGTTCCCTCTTTTTCTCCTGCTTTGCTGGCCACGCCCACTCCTACCTCTGCTTGCAGTGCTCCACACCCATCATGAAGCATTTTTTAAAAAGAAAAAAATTGCTGAGGTTTGCTTAAATCGAAATATGGGGTTTAATGGCC
OTHER a235 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous astn1a235/a235 astn1 ♀+/- ♂+/-

CITATIONS  (1)