ZFIN ID: ZDB-ALT-190123-677
Genomic Feature: sh336
Synonyms:
Affected Genomic Regions: nos1 (1)
Type: Indel (1)
Protocol: embryos treated with TALEN1-nos1
Lab Of Origin: van Eeden Lab
Location: Chr 5: 12219244 - 12219251 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 1 bp inserted / 8 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
TGCTTCTTTTTTCTGTTAAATATAAAAGAAGATATTGAAGAAATTAAAGGTATTGAAGATTGTCTTGAGTATTGCCACAAAGACATTGATGCATTAATGACATCCCTCACCTCTCCACCTGCACCTCTGCATCCTTCCTATCGATGACCCTCTGGCCCTCTCCGTTGATCTCTTTTTTGCTGTTCTTGATGAGCTTCAGCACAGGCTCGATCTCTTTCAGCAGGTCATTGTTATCCTCCACCCCATTGAGGAGAAGTCCCGCGTGGCCTCCTTCTCTGAGAAGAGAGTCCTGTGACAGCAGGGGAATCAGGGGTTTGTCATCCCGCGACTCTTTCCTGGGAGTGGAGGAAGAGGATAGGTTTTCTATTGCCCTGAGCTCTTTGGTCATGTTGGGCGTGAGGGGCGAGCATCGTTCGCATGGCCTGCTTTGGGCCGGGTTGACAGGCCTGGTGACCCGAATCGTCTTGGTTTTTCCATCACTGCTCAGCGTGGTCTCCAGG
TGAGTGGT/A
GAAACCCTCTGGTCCACGAAGGATCAGGACAGCGTGGCTTTCGGGTGACACGTTCTTCAGGGTTTCAAGAGCACGTTCATAACTCATGTCCACCAACGGCTTGTTGTTTACAGCAAGGACGATGTCGCCCACTTGGACAAGCCCGCATTCCTCCGCCGCTCCTCCCCGGATGAGGTCCGAGACGATGACAGGTGGTTTGCACACCCGCTGCTTGACCAGAAAGCCCAGTCCACCGATCTTTCTTTTAAAGAGGCGAACTGAGATGATGTTGGGCTGTAGTTGACACACGCTGGGCTCTGATTCCTGCATTGTGTCTTACTGTGCGTCAACGCTGATCTGCGATTGAGCTAAATGCGACAAAGGAGAACAACGTGTCAGATGTGTCAGACATGCATGAGATGAAAAGATATGCAGAGCTGCAAGACAATGCAGGCTTTTTTCCATTCTGTGACATTTAAGAAAGTGCTCACTTTCAATTAAGTCCAACTATGTATGAATAT
Comment Citation
mutation sequence details
nos1, exon 1
wild type  ...
GutiƩrrez et al., 2017
OTHER sh336 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous nos1sh336/sh336 nos1 ♀+/- ♂+/-

CITATIONS  (1)