ZFIN ID: ZDB-ALT-180522-1
Genomic Feature: ltu1
Synonyms:
Affected Genomic Regions: grhl3 (1)
Type: Indel (1)
Protocol: embryos treated with CRISPR1-grhl3
Lab Of Origin: Dworkin Lab
Location: Chr 17: 26968290 - 26968292 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 17 bp inserted / 3 bp deleted from position 26968290 to 26968304 in Exon 4 (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Polypeptide Truncation: at position 143 (1)
FLANKING SEQUENCE (GENOMIC)
AAAAATAGCAGCCTACAGAGCTTGTTGGTCTCCCCGATGTCAAACCCTGCCGAGAAACTCAAACAGTAAAAAAAAGTCAGCGTTAGGTGGCAAACAGCTCCCGCCCAATGTGTTTGGCTTGGCTTTTCACGCACTGAAAGCTCCATAAACAATGCGGAGATTGAGTAAAGCTTTTTATTGACTTTGACACATTTTTTGTGATCGTTGTATAGGTAGCTAACAGCTGCTCTTGTGTGAATAGCATTAGTGATCGAGTAGGATAAAAACACAATCCTAATTCGAAACAAGGAGACTTACGATACGTCATGTGATTTATGTTGTAGGACGGCAAACAGCTCTTCCCCTGAACTTGCCCCGCTGGAGAACGCTCACATCATGAAGTTCCTTTCAGAAAACATGTCCTTCAACCCCTCAAAGCCTAGCACTGACAGCTACACAACAGACAACTATGATAAGCAAGTCAACCTGAACAACATCTTCGACTCTCTCCTGCCTCAACC
GTC/TTAATTAAGCTGTTGTA
GCAGAAATCATGGCAATCGGATCAAACCTTTCTGGAGGCCACACCTGAGGTCCGCATTTATGTAATACATTTTCCCAAGACACATTTACAATATACATTAATATAACAACATTCAAGTTTAGGTTATCTTTATATTAAATATTATTTTATGTCTTTTTAGTCATAGAAACTAATGTATTCTTAATTATTGTACTTACTTAATAATTATGATCAATTTGTGACACATCTGTTTGTTTACTTCACAAAAAACAGCATATTGGCCACAATGGATTTGGGGGACAGACAAGCCCTGTTTACTCAGATTCCTACTCTTCTCCAGGAAGATACAGGTAAGATTTTACAAATCGGTCAATTCTCATGCATTTTGCCTCTATAAAAATAACTATGTCACTTGGTGATCCTATGCAAGCCATAAAAAAAAATCAACACTGAGTAATGCTGTTGCATTAATATATTTGCATTTGAATGTTTTCGCAGGAATGATTTCCAATTCCTTCTCG
OTHER ltu1 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous grhl3ltu1/ltu1 (TU) grhl3 ♀+/- ♂+/-

CITATIONS  (1)