ZFIN ID: ZDB-CRISPR-180514-2
CRISPR Name: CRISPR1-grhl3
Target: grhl3 (1)
Source:
Target Sequence:
5' - GGTTGCCATGATTTCTGCGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-grhl3 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-grhl3
Genomic Feature Affected Genomic Regions    
ltu1 grhl3    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-grhl3 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-grhl3
No data available

Phenotype of all Fish created by or utilizing CRISPR1-grhl3
Genome Resources:
CITATIONS (1)