ZFIN ID: ZDB-ALT-180207-2
Genomic Feature: au60
Synonyms:
Affected Genomic Regions: tet3 (1)
Type: Indel (1)
Protocol: embryos treated with TALEN3-tet3
Lab Of Origin: Gross Lab
Location: Chr 5: 14316746 - 14316768 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 1 bp inserted / 23 bp deleted in Exon 6 (1)
Transcript Consequence: Frameshift, Premature Stop (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCENo data available
NOTES
Comment Citation
22bp deletion mutation predicted to cause a frameshift beginning at aa 1,212,  ... Zebrafish Nomenclature Committee
c.4,860_4,881delGAGATAAACTGTACAGAGAAGT,
p.Gly1,212Alafs*92 ;
protein truncation  ...
Seritrakul et al., 2017
OTHER au60 PAGESNo links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Heterozygous tet3au60/+ (AB) tet3 Unknown
Complex tet2au59/au59 ; tet3au60/au60 tet2, tet3
tet3au60/au60 ; zc7Tg ; tet2au59/au59 tet2, tet3

CITATIONS  (2)