ZFIN ID: ZDB-ALT-160729-5
Genomic Feature: dtwc3
Synonyms: moonstone (1)
Affected Genomic Regions: ltk (1)
Type: Point Mutation (1)
Protocol: embryos treated with ENU
Lab Of Origin: Nüsslein-Volhard Lab
Location: Chr 17: 31406257 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Missense (1)
Protein Consequence: Amino Acid Substitution: Phe>Ile at position 993 (1)
FLANKING SEQUENCE (GENOMIC)
AAAATCAGGAGCAAATAAAAAAACTCTCATACAGAAAATGAGCGAGAAAACAGACATGTGACATTAAACATGAAAATATTGAGATTCAGCAGACATTCAAAGAACTTACACTTCAGTCTATATAATGAGAATGTTAATGTGTTTTTGACTTTCGATGGATGTAAATTTAATGTAGTGCACTAAAATAAAATATAAACCTGTGAAATAGCTTAAAATATGTGCTTGAATGATAAATAGCACATGTGTTAATGTTTGTTTTCTAATGCAAAGAATGTTCCTGCACATGTGGCCAAACCACCGTCATAAAAGCAAAAATGTGTGTTAACTGAGAAACATATGATAGTACAAAGTCTGAATGCACTTAAAAAGGCTCACAGTTCTGGGTCGATTGAGTCTCAAGAAGCTCTTCATGTCTCCTCCTGTCATGAGCTCCAGCAGGATGAAGCGTGGCAGGATCTGCAGACTGACGCCAATGCAGCGGACAATGTTCTGATGGCTGA
A/T
CTTACTGCAGACACACAAGAAAACCCAAGTGAACTACTGACTGGAAGAACGAGTCAGCTTGATTCTCATACATCAAAACATGTCATAACAGTACTCAACCACAATTCTCAGATATGTGACCCTGGACCACAGAACCAGTCAAATTTTGGAAACGTACGAATTATAATTTTGGGATTTGTGTATTGCCTGAAAGTTAAATAAATTTGTTTTCTATTGATGTGTATTTTGTTAGGACAGGACAATATCTGGCCCAAATACAACTATTTGAATATCTGGAAAATACTAAGAAAATCCTGTTTAAACTTGTTTAAATGAAGTTCTCAGCAATGCATGTTACTAATCCAAAAATGAGTTTTGATATATTTATGGTAGGAAATATTACAAAAGGCGACAAAGTGGCTCAGTGCTTGGCACTGTCGCCTCACAGCAAGAAGGTTGCTGTTTCGAGTCCTGGCTAGGTCAGTTGGCATTTCTGTGTGTAGTTTGTATGTTCTCCCTGT
(1)
Comment Citation
change in the kinase domain of the protein, which is highly conserved  ... Fadeev et al., 2016
OTHER dtwc3 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous ltkdtwc3/dtwc3 ltk ♀+/- ♂+/-
Heterozygous ltkdtwc3/+ ltk Unknown
Complex ednrbatlf802/tlf802 ; ltkdtwc3/+ ednrba, ltk
ltkj9s1/+ ; ltkdtwc3/+ ltk
kitab134/b134 ; ltkdtwc3/+ kita, ltk
t32238Tg ; sb1Tg ; ltkdtwc3/+ ltk
t32238Tg ; tdl358Et ; ltkdtwc3/+ ltk

CITATIONS  (2)