Genomic Feature

sa17802

ID
ZDB-ALT-131217-13878
Name
sa17802
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation
Protocol
adult males treated with ENU
Lab of Origin
Stemple Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
European Zebrafish Resource Center (EZRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 5: 40155175 (GRCz11) (1) Details
Nucleotide change
C/T
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>A (1)
Transcript Consequence
Missense, Splice Site (1)
Protein Consequence
None
Sequences
Flanking Sequence
TTCGGGAATCATGCATTAAGCACGTCAAATGCTCAATTCGCACCATGTCATCTCATCATTCGCGCCGCCTAATTTGCGCAAATAGTGCCGCATGATGTCTGATCACATCTATACATTGACTTAACATGTAAATCACTCACACTTGACACTTTATCCGCATCTGAGGTGAACATCAGTCTAAATTTTCAGTACAAAAATTTCCAATTGTCCAGAAGAGATTAAATCATTATTTAAATTTTATGTTGACTACGAAAAGTCCTAAAAGCAAAACAATTGAAAAAAAAAAAAAAAAGAATAATCGCAAACATAAAAGCACACTAAATCCCTACTTAAGCCCTAACACTGCAAACTTGCCATCTGAATCCTGTGAATGCCTCGATTTCTTAGTGTTTCCTGGCTGAAGTTCAACACACCCGGAATTTCACATCACCAGCTTTCACACCCAGCTGTGCAATGACACAAGTCAAGACTCCAGTGTATGCTATTTTATAGAGGGCTGA
C/T CTTTCCCAGAAGGCTGTGGAACCACAAAACCTGGAAGCAGGAAGGGTGCTCCGGTGGTAAGTCCAGCTGGCTTCAGCTCACTGACACCATATGTGGTCAGAGCGGTCACCAGGTTCACCAGGTCCTTTAGAGCATCTTTGGATTCATCCTCTTTGGCCTGCTCCAACCTAAGAAGTAGAGCAAGTACAACAGAGAATATCACTAATCGATCGTATCAGGATTGCAAAAAAACTTTTATTAGCACATTTAAAAGACAAATATTTAGGGGTAAGTGATCTTTTTACATAATGTAAAAGGATAGTTCACCCAAAAATCATTTACTCATCCTTGACTTGTTCCAAACCTGTTTGAGCTTTGCTATTGTGTTGAACAAAAAAGAAGTTATTTTGAAGAATGTTGGAAGCATTAAGGAAATATATAAGTCTATAATAACAGGTTTCCAATATTATTTAATATATCTTATGTGTTCAAGAGAAGAAAAAAAAACTTAAACTGGTTTG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations