Genomic Feature

zdf1

ID
ZDB-ALT-050428-2
Name
zdf1
Synonyms
  • e7 (1)
  • M214K (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
A. Thomas Look Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
This is the tp53 M214K missense mutation in the p53 DNA-binding domain, preventing activation of p53 target genes.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 5: 24092412 (GRCz11) (1) Details
Nucleotide change
T/A
Variant Notes
This is the tp53 M214K missense mutation in the p53 DNA-binding domain,  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A in Exon 7 (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Met>Lys at position 214 (1)
Sequences
Flanking Sequence
ATATCGGTTTCACTATGTGAACAGCTCTATTTTTGATGTACTCGTTCAAATTTTGCCAAATTCACAAGTGTCCTGTTATCGATCTAATTGTTTATGTTTTTGGATTCTGTTTGGTTTTGTACAATGAGTGAAGTATAGTTGCATGTTAATTTCAGTTGTAATAATGTCTGAAGTCTTTAATCTTTTAAAAGTAGTAGAATTATATCAAAGGCCAGCATTAGATTTTAACTTTTATCTTTTATGTATTGTTTATTGTTGCTTATTTGTTTGTTTTTTACTGTTGTAATTCTTTTTTTTTTTTTTAAGGGAAAGTGTGATTTACAAACTCTTTTTTTATTTTTATTTTATTATTATTATTATTATTATTATTTACATGAAATTGCCAGAGTATGTGTCTGTCCATCTGTTTAACAGTCACATTTTCCTGTTTTTGCAGCTTGGTGCTGAATGGACAACTGTGCTACTAAACTACATGTGCAATAGCAGCTGCATGGGGGGGA
T/A GAACCGCAGGCCCATCCTCACAATCATCACTCTGGAGACTCAGGAGTAAGTACTGCATATTTGATTCCTCCTCTTGTGAACTGCTTTTTTAAATTTATTTTTTATTTTTTTGATGCTTCATGATGCTGCTCTCATATTAAATCACTACAAATTTGTCGATAATTTTTCTTAACAAAATAAGAGTGTGCTCGCACTAGGCTATCCGAAACAGTTCAGTTGCCTTGCCATGGCCCTGTTGGAAGAGGCATGCCATTGGGCTTTGGCGAGGTATGCTTTTAGTGTGAGTGCAAAACGTGCCTGAGCATAAAACTGAAGACCCGACATCACCTTTAAGGGACTAATTGTTCTTTCTTTTAGTTGATTAATTTTATTCTTTCTTTTCACGTAAGTCATATTTTATTAAATGTGCAAACCTTTTCTTCTTTAATGACGAGACGACAACTCTTACCCCACAATATATGTATATTAGATGCTGCTTTGCATCATATACAAAGATAATT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
zdf1.pdf
Citations