Genomic Feature

tm213

ID
ZDB-ALT-020715-8
Name
tm213
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
Lab of Origin
Nüsslein-Volhard Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 3: 43600982 (GRCz11) (1) Details
Nucleotide change
A/T
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Leu>Gln at position 399 (1)
Sequences
Flanking Sequence
ATTCATTTGAGTAGGTAATTCAGCTCATAAGTTTTTAAAATAAAATCAGTTGTTTGCGGTATAAAAATACGAGATTTTGAAATATTTATTAGCTAATATATCGGTTATTGGCCTCCAAATCGTAAGAGTAAGCTGTTATCAATATCAGTAAAAAAAAAAAATAATAATAATAAAAATATATTGGTGCATCCCTACAGAGAAGTATAATTGCTCACACCAACATCAGCTACATGCAAGATATATGTTGTGGGGTATGGCATAAATTGCTTATCAATAAATGATGCTCCTTCATTCCAAACCAAAATTCCTAAATCTAAAAATAAACTAGTGACAACAAATTGTAACAGAATTTTAATTAATTACACCAGGAAATTCATCCAGTCTAATTATACCTCAAAATGCGTTAGCAGTGTGCTGATGGAGCTGTACTCACCAGTCGAACCCTCTTGAGACGCTCCTCCAGCTTCTCCTGCGCCTCTCGTTCCCTCAACACCCCCTCC
A/T GCCTGCTGATCAGCTCCGCCGCAAACTTCTCTGGCTCAACGTGAATATCCTTTGGTATCCGGTTTGTGCGCTGATGGGAAGACAATGAAAGAACTCAAGGTCACCATTCACATTTAATGCGATGCTGTGGAGAAAACACCTCCAGCTGTTGATTATACAGGTATGTGGACAGACAAAAATAACAGAGGAACATTAAAACGGGCTGGACAGACAAATGGAGGACACATTTTTGGACAATGTGTGATAGAGAATGAACACGAGGATTCTGTATACACATCGGTTTCAGTTTAAAAGCATCACCTCAAGGACAAAACATGGTACATCTCCAGCAAACAGGATAGACTGCTGAAATCCATGTTTACAGCTGCCAAATATATCATGTCAATCAACATACAGCAATTTCGTGAGGAACTAGCTTATTCTGTACACGCAAATGAATGATAATAGGGATTTGGAGATTCACTTAAATATTTAAATGTGGTTGTCATGGAATATTAGGC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations