Transcript

tbk1-005

ID
ZDB-TSCRIPT-210816-1
Name
tbk1-005
Previous Names
  • TBK1_tv2 (1)
Transcript Type
mRNA
Annotation Status
published
Associated With Genes
Strain
Non Reference Strain
Genome Resources
None
RNA Central
None
Note
Zebrafish TBK1_tv2 isoform (GenBank accession no. KR781019) excises exons 4–18 and encodes 130 aa. Similar to TBK1_tv1, TBK1_tv2 contains an incomplete STKc_TBK1 domain.
Sequence
ZFINNUCL0000006167 (1) [ Show ] (double-click sequence to select) [Download]
>lcl|ZFINNUCL0000006167|ZDB-TSCRIPT-210816-1 publishedRNA tbk1-005 mRNA published 405 bp
TCTACAGTCATCATGCAGAGTACGGCCAATTACCTGTGGA
TGATGTCCGACCTGCTGGGTCAGGGAGCCACAGCTAACGT
GTACCGCGGTCGACACAAGAAAACAGGCGATCTGTACGCC
GTCAAAGTGTTCAACAACCTGAGTTTCCTGCGGCCGCTGG
ACGTGCAGATGAGGGAGTTTGAGGTGCTGAAGAAACTCAA
TCACAAGAACATCGTCAAGCTGTTTGCCGTCGAGGAGGAG
TCGAACACACGTCATAAGGTGCTGGTGATGGAGTACTGCC
CCTGCGGGAGTCTCTACACCGTCCTGGAGGGAGTGGTGAA
GGAGCTGGCGGAGAACAACCTGTTCCTGGAGAGATTCGGC
TCACTGACGGTGGATGGAGGAATGAGGACAGTGGAGCGGA
TGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations