Transcript

tbk1-201

ID
ZDB-TSCRIPT-110325-1275
Name
tbk1-201
Previous Names
  • tbk1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048966 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048966|OTTDARG00000034586|ZDB-GENE-060512-359 tbk1|OTTDARP00000038423 tbk1-001 LG_none FP245483.5,FP017216.4 Danio rerio protein_coding KNOWN, 2921 bp
GTCTCTCATGTGATGAAAACACGGAAAACGGAAGAGACTG
TCGTACTCTCGGGGTGGATCTACAGTCATCATGCAGAGTA
CGGCCAATTACCTGTGGATGATGTCCGACCTGCTGGGTCA
GGGAGCCACAGCTAACGTGTACCGCGGTCGACACAAGAAA
ACAGGCGATCTGTACGCCGTCAAAGTGTTCAACAACCTGA
GTTTCCTGCGGCCGCTGGACGTGCAGATGAGGGAGTTTGA
GGTGCTGAAGAAACTCAATCACAAGAACATCGTCAAGCTG
TTCGCCGTCGAGGAGGAGTCGAACACACGTCATAAGGTGC
TGGTGATGGAGTACTGCCCCTGCGGGAGTCTCTACACCGT
CCTGGAGGAGCCCACCAATGCGTACGGCCTGCCGGAGGAC
GAGTTCCTCATCGTTCTGCAGGACGTCGTGGCGGGAATGA
ATCACCTGCGCGAGTACGGCATCGTGCATCGAGACATCAA
GCCAGGGAACATCATGCGAGTGATTGGAGACGACGGATTC
TCTGTGTACAAACTCACCGACTTCGGAGCCGCTCGCGAAC
TGGAGGACGACGAGCAGTTCGTATCGCTGTACGGCACAGA
GGAGTATCTGCATCCAGACATGTACGAGCGGGCGGTGCTG
AGGAAAGACCACCAGAAGAAATACGGCGCTACGGTGGATC
TGTGGAGCATCGGAGTCACGTTTTACCACGCCGCCACCGG
CAGCCTGCCGTTCAGACCCTTCGAAGGGCCGCGCAGAAAC
AAAGAAGTCATGTATAAGATCATCACAGAGAAGCCCCCCG
GCGCCATCTCCGGACACCAGAAGTTTGAAAATGGGAAGAT
CGAGTGGAGCTCCGAGATGCCCATCTCCTGCAGCCTGTCC
AAGGGTCTGCAGAGCCTCCTGACGCCGGTGCTGGCGAATA
TCCTGGAAGCGGATCAGGAGAAGTGCTGGGGGTTTGATCA
GTTCTTCGCAGAGACCAGCGACATCTTACACCGCATCGTG
GTCTACGTCTTCAGTCTGCAGCAGGCCACGCTGCACCACG
TCTACATACACACTTACAACACAGCGAACCTCTTCCAGGA
GCTGCTGTTCAGACGCACCAACATCACTCCGTCCCATCAG
GAGCTGCTCTACGAGGGCCGACGGCTCGTCCTCGACCCCA
ACCGGCAAGCACAAACCTTTCCCAAGACCTCCAGAGACAA
TCCCATCATGCTCCTGTGCAGAGACCCCGTCAACACCGTC
GGCCTGCTGTTTGAGGACCCCAGCCCACCCAAAGTACAGC
CGCGCTACGACCTGGACCTGGACGCCAGCTACGCCAAGAC
GTTCGCAGGTGATGTGGGATACCTGTGGAAAACATCAGAT
TCTCTGCTTCTGTACCAGGAGCTGGTGAGGAAAGGAGTCC
GAGGCCTGAATGAGCTGATCAGAGATGAGTACAGTGAGAC
GATGCACAAGAAGACGGAGGTGTTCCACCTGTGCAGCCAC
TGCAGCCAGACACTGGAGCGCAGCGAACAACTCTGTGAGG
CGCTGATGCAGGGAAATATCCTGTCAGCCGAGTATGACGA
GATCCGAGACACCAGGAAGAAGGTGCTGCGGCTCTCAGGC
TCTCTAGCCTCTATGGATCAGACTCTGCAGGACATCAACA
GCATGTTCCTGCCCGGAGGAAGCCTGACCGACACCTGGAC
GCAGCAGGTGGGAACACACCCCGAGGACCGCAATGTGGAG
AAGATCAAGGTCCTGCTGGACGCCATCGGGGCCATTTACC
AGCAGTTCAAGAAGGACAAGGCGGAGCGGCGTCTACCCTA
TAATGAAGAGCAGATCCACAAGTTTGACAAGCAGAAGCTG
GTCCTTCACGCCACTAAAGCGCGAGCTCTGTTCACAGACG
AGTGTGCCATGAAGTATCGCCTCTTCATCTCCAAGAGTGA
GGAGTGGATGAAGAAGTTTCATCACGTGCGGAAGCATCTC
CTGTCTCTGACTGGTCAGTTCAGCAGCCTGGAGCAGGAAG
TGACTCTCCTCATGCAGCGCCTGTATAAGCTGCTGGAGCA
GTTCCCACAGAAGGTGGTCCCGATGGCGTCTGGTGTCCTG
AAGCCGCAGGCGTATCTGAGCCCCAGCACACTCGTGGAGA
TGACCCTTGGGATGAAGAAACTGAAGGAGGAGATGGAGGG
AGTGGTGAAGGAGCTGGCGGAGAACAACCTGTTCCTGGAG
AGATTCGGCTCACTGACGGTGGATGGAGGAATGAGGACAG
TGGAGCGGATGTGACATATACACACACACACACACACTTT
CACATACACAGAGATGCACACATACACACACACACACACA
CACACAGTCTCTGTCTGTCTCTTGTACATATGGACAGTCT
GTATATACTCTCTCTCTCTCTCTGCTTCAGTTGCGTCAGG
ATCAGCACTGTTACTGTTTTAAGTTCTGCTCTTCTCCTCA
TCAGTGTGTGTGTGTGTGTGTGTGTGCATGTGTGTGTGTG
TTTCACTGAAGCGCTCTCTCTCTCTCTCTCTCTCTCTCTC
GGTCAGTGTAAATCAGGACTCTTGATATTTATAGGGCTTC
ATGTTTCTTTGTGTAAATGAGGATTAAACAGCAGCAGCGC
TGAGTTCTGCTCAAACCTTCATCTGCTCGTCTGCTTCAGT
CCAGCTCCACACACACACTCCATCCTCACAGCACACACAC
TCGCTATCATCTGTTAGAGCGCACACACACACAACATACG
CCACTTTAGGCTGGAGTTAGTAATGATGGTAATCAGAGTT
CGCCACAGTGCAATGAACCACCAACTATTCCAGCATGTGT
TCCACAGTACCCTTCCAGCCACAAGCCAGTACTGGGAAAC
ACCCAAACACACTCATTCACACACACTCCCGTGTGTGTGT
GTGTGTGTGTGTGTGTGTGTGCGCGCACAAATGCAGTTTG
T

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations