Transcript

ppp1r12a-tv201

ID
ZDB-TSCRIPT-200625-1
Name
ppp1r12a-tv201
Previous Names
None
Transcript Type
mRNA
Annotation Status
published
Associated With Genes
Strain
Non Reference Strain
Genome Resources
None
RNA Central
None
Note
None
Sequence
ZFINNUCL0000006156 (1) [ Show ] (double-click sequence to select) [Download]
>lcl|ZFINNUCL0000006156|ZDB-TSCRIPT-200625-1 publishedRNA ppp1r12a-tv201 mRNA published 3313 bp
AAGAAGCGCCAGGCTCGAGGGGATGAAGATGGCGGACGCC
AAGCAGAAGCGGAACGAGCAGTTAAAGCGCTGGATAGGCT
CGGAGACGGACCTCGAGCCGCCCCTCCTGAAGAAGAAGAA
GACGAAGGTGAAGTTCGACGATGGCGCCGTGTTTCTGGCC
GCCTGCTCGAGCGGAGACACGGAGGAGGTGCTGCGAATGC
TCGATCGCGGCGCCGACATCAACTACGCCAATGTGGACGG
GCTCACCGCTCTGCACCAGGCCTGCATAGATGATAATGTG
GACATGGTGACCTTCTTGGTGGAGCATGGAGCCTGCATTA
ACCAGCCTGATAATGAAGGCTGGATCCCCCTTCACGCCGC
TGCCTCCTGTGGATACCTCGACATCGCTGAGTATCTTATC
TCTCAAGGTGCGAGCGTTGGTGTAGTAAACAGCGAAGGAG
AAACGCCATTAGATATCGCAGAAGAGGAGGCCATGGAGGA
GCTTCTGCAAAACGAGATCAACCGGCAAGGCGTGGATATC
GAAGCAGCCAGGAAGGAGGAGGAGCGTATCATGCTAAGGG
ATGCACGACAGTGGCTTAACAGTGGCCAGATCAACGACGT
CCGGCACACCAAGTCTGGGGGTACCGCACTCCATGTTGCT
GCGGCCAAGGGATACGCTGAGGTTTTAAAGCTTTTAATCC
AAGCAGGGTATGATGTAAATATTAAAGACTACGATGGCTG
GACTCCGCTCCACGCTGCTGCACACTGGGGCAAAGAGGAG
GCCTGCCGGATACTAGTAGAGCATTTGTGTGATATGGACG
TCGTCAATAAAGTGGGTCAGACGGCATTTGACGTAGCTGA
TGAAGATATTTTGGGATATTTAGAAGAGCTGCAAAAGAAA
CAGAATCTGCTTCTTAGCGAAAAGAAGGATGTTAAGAAGT
CTCCTTTAATAGAAACTACGACTACTGGGGACAATAATCA
ATCTGTGAAACCACTGAAGAGCAAAGAAACACTTCTACTG
GAGCCTGAGAAGACTGCGCCAAGAATCGAGACTCTGGAGC
CAGAGAAGGTGGATGAAGAGGAGGGAGAGGGAAAGAAGGA
CGAGTCTAGCTGCTCGAGTGAGGAAGAGGAGGAAGAAGAC
TCGGAGTCTGAGAACGAAGCAGATAAGACCAAGTCTTCTG
TTCCGTCAAGCGTTTCCAACAGTACACCTACAACTGCACC
TTCTAGCATCACCGTCACATCACCTACTACCCCAAGCAAC
CAGGTGACCACCCCAACCTCACCTACCAAAAAGGTGAGCA
CACCTGCAGGGAAGCTGTCTCCTAAAGAGGAGGACAGGAA
GGATGAGTCTCCTGCATCGTGGCGTTTGGGTCTGCGCAAA
ACTGGCAGTTACGGAGCTCTGGCAGAAATCAGCACAACCA
AAGAGGCACAGAAGGAGAAAGACACAGCCGGGGTGATGCG
CTCTGCCTCTTCCCCTCGCCTCTCATCCTCACTGGACAAC
AAGGACAAGGAAAAGGAGAAGGAGAAAACACGCCTGGCAT
ATGTTGCACCAACTATACCGAGGAGACATGTTAGCACCTC
AGACATCGATGAGAAGGAAAACAGGGATTCGGCTGCTAGT
CTGGTACGTAGCGGCTCGTACACAAGGAGACGCTGGGAAG
AAGACCTGAAGAACAGCGATGGAACGGCCTCAACAAACAG
AACCTCCAGCTATCAGCGCAGTACGTCACACACGCTAGCG
TTAGGCCGCACGTCTAGCTCTCGCGACCTGCCCGCCAAAT
CCTCCTCCGCCTCCAGCCTGGAGCCTAACAACTCTAAAGC
CTGGCAGCCTTCCTCCTACTACCAGTCTTACAGCATTCAC
CGCAGCGGCTCATTTGGAAGAAGACATGAAGATCCTTTGA
GTTCTACTTCCTCGTCCACAACAACGACCACCACCACCTC
CTCTGTTACCTCACCTACAGGACACCGCAGCCTGCTTAAC
AGGTATTGGGCAGAGGAGAGCGCAGAGAAGGAGAAAGAGA
AGGAGAAAGAGTCGGCAACCGTTATCCCTACAATCAACAC
TGCAGGCACCACCACTACCACATCCACCACTGGAACTGTC
CTGGGCTCTGACGGGCGAGAGAGACGCAGATCGTACCTCA
CTCCAGTACGAGATGAAGAATCTGAGTCTCAGAGGAAAGC
CAGATCCAGACAGGCACGACAGTCCAGGAGATCTACACAG
GGTGTGACATTGACAGACCTCCAGGAGGCCGAGAAGACCA
TCGGTCGCAGTCGCCCCACACGGCCTCGAGAAGATGAAAA
AGAAGAGAAGGAGAAACAGGACAAGGAGAAACAGGAGGAG
AAGAAAGAGACCGAGACCAAGGAGGATGACTACAGGTCGC
GCTATCGTAGCTTTGAAGAGAAGTATCGCACCTCGTTGGC
CTCCAGCACCACAGCGTCCTCCACCATCCCTTCATCCTCA
TCCAGTAGCTCGTCTTCTCTGTACAGCACCTCGTCTCTGA
ACCGACCCAACAGCCTGACGGGGCTCACTTCAACATACAG
CCGATCTACACGCGACACCGACAGAGAATCTGATCGAAAA
GAGAAAGATGAGGATAGAGACGGTGATGACAAGTCTCAGC
CACGCTCTATACGCGACCGCAGACGACCTCGAGAGAAAAG
ACGATCCACTGGAGTGTCCTTCTGGACCCAGGATAGCGAC
GAAAATGAGCCAGATCATCCCTCAGATTCAGAAGGCAGCA
CTAAAGGAGAGCCTCAGGTGAATATCAGCAGCAATGACCC
TCTCTCTACTAGCACTTCATCCACTGACCGTTATGAGTCT
TTGAGTAGCCGTGGCATTGGGGAGAGCCGACGTCCGTACT
CTCGTTTCGAAAAAGACGATTCCACTGATTATAAGAAGCT
TTATGAGCAGATTTTAGCTGAAAACGAGAAGCTGAAAGCT
CAGTTACGCGATACAGAATTGGAGCTGTCAGACCTAAAGC
TACAGCTGGAGAAGGCCACACAGAGACAGGAGCGCTTTGC
CGATCGATCACAGCTGGAGATGGAGAAAAGGGAAAGAAGA
GCTCTAGAAAGGAAGATCTCTGAGATGGAGGAGGAGCTGA
AGATGCTACCAGACTTGAAAGCCGACAACCAGAGACTAAA
GGATGAAAACGGAGCGCTGATCCGAGTAATAAGCAAGCTT
TCCAAATAGAGCCGACCCTCCGGCAGTAACGGTATTGCAC
ATCTAGATATTAACACGAGACAATGGCGACAAAGAAGGCT
CCGTCTCCCCCCATTGCGTTTCCCAGCTTTCCCCTTGCTT
CTCACCACACAGAACCACTGCGTTTATGGAACT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations