Transcript

ppp1r12a-201

ID
ZDB-TSCRIPT-090929-1546
Name
ppp1r12a-201
Previous Names
  • ppp1r12a-001
  • tv203 (1)
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000009599 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000009599|OTTDARG00000008393|ZDB-GENE-041011-3 ppp1r12a|OTTDARP00000008264 DKEY-28J4.1-001 LG_ BX537286.4 Danio rerio protein_coding NOVEL, 4846 bp
ATGACGTCATGCTGCAGATCCGGAGCTGTGACGTCGCACA
TTCTCGCGATATCTCGACGTAACCAGGTTTGTTCACCACC
AGTCACCCCCCTCTCTTTCGTACCGTACCGTCCCCTCCCA
CGCCCCAGCGCGCCGAGTCGGGATAGTGGCAGTATAAAGT
ATATCTTCCATCCGAGACAGATAAGAAGCGCCAGGCTCGA
GGGGATGAAGATGGCGGACGCCAAGCAGAAGCGGAACGAG
CAGTTAAAGCGCTGGATAGGCTCGGAGACGGACCTCGAGC
CGCCCCTCCTGAAGAAGAAGAAGACGAAGGTGAAGTTCGA
CGATGGCGCCGTGTTTCTGGCCGCCTGCTCGAGCGGAGAC
ACGGAGGAGGTGCTGCGAATGCTCGATCGCGGCGCCGACA
TCAACTACGCCAATGTGGACGGGCTCACCGCTCTGCACCA
GGCCTGCATAGATGATAATGTGGACATGGTGACCTTCTTG
GTGGAGCATGGAGCCTGCATTAACCAGCCTGATAATGAAG
GCTGGATCCCCCTTCACGCCGCTGCCTCCTGTGGATACCT
CGACATCGCTGAGTATCTTATCTCTCAAGGTGCGAGCGTT
GGTGTAGTAAACAGCGAAGGAGAAACGCCATTAGATATCG
CAGAAGAGGAGGCCATGGAGGAGCTTCTGCAAAACGAGAT
CAACCGGCAAGGCGTGGATATCGAAGCAGCCAGGAAGGAG
GAGGAGCGTATCATGCTAAGGGATGCACGACAGTGGCTTA
ACAGTGGCCAGATCAACGACGTCCGGCACACCAAGTCTGG
GGGTACCGCACTCCATGTTGCTGCGGCCAAGGGATACGCT
GAGGTTTTAAAGCTTTTAATCCAAGCAGGGTATGATGTAA
ATATTAAAGACTACGATGGCTGGACTCCGCTCCACGCTGC
TGCACACTGGGGCAAAGAGGAGGCCTGCCGGATACTAGTA
GAGCATTTGTGTGATATGGACGTCGTCAATAAAGTGGGTC
AGACGGCATTTGACGTAGCTGATGAAGATATTTTGGGATA
TTTAGAAGAGCTGCAAAAGAAACAGAATCTGCTTCTTAGC
GAAAAGAAGGATGTTAAGAAGTCTCCTTTAATAGAAACTA
CGACTACTGGGGACAATAATCAATCTGTGAAACCACTGAA
GAGCAAAGAAACACTTCTACTGGAGCCTGAGAAGACTGCG
CCAAGAATCGAGACTCTGGAGCCAGAGAAGGTGGATGAAG
AGGAGGGAGAGGGAAAGAAGGACGAGTCTAGCTGCTCGAG
TGAGGAAGAGGAGGAAGAAGACTCGGAGTCTGAGAACGAA
GCAGATAAGACCAAGTCTTCTGTTCCGTCAAGCGTTTCCA
ACAGTACACCTACAACTGCACCTTCTAGCATCACCGTCAC
ATCACCTACTACCCCAAGCAACCAGGTGACCACCCCAACC
TCACCTACCAAAAAGGTGAGCACACCTGCAGGGAAGCTGT
CTCCTAAAGAGGAGGACAGGAAGGATGAGTCTCCTGCATC
GTGGCGTTTGGGTCTGCGCAAAACTGGCAGTTACGGAGCT
CTGGCAGAAATCAGCACAACCAAAGAGGCACAGAAGGAGA
AAGACACAGCCGGGGTGATGCGCTCTGCCTCTTCCCCTCG
CCTCTCATCCTCACTGGACAACAAGGACAAGGAAAAGGAG
AAGGAGAAAACACGCCTGGCATATGTTGCACCAACTATAC
CGAGGAGACATGTTAGCACCTCAGACATCGATGAGAAGGA
AAACAGGGATTCGGCTGCTAGTCTGGTACGTAGCGGCTCG
TACACAAGGAGACGCTGGGAAGAAGACCTGAAGAACAGCG
ATGGAACGGCCTCAACAAACAGAACCTCCAGCTATCAGCG
CAGTACGTCACACACGCTAGCGTTAGGCCGCACGTCTAGC
TCTCGCGACCTGCCCGCCAAATCCTCCTCCGCCTCCAGCC
TGGAGCCTAACAACTCTAAAGCCTGGCAGCCTTCCTCCTA
CTACCAGTCTTACAGCATTCACCGCAGCGGCTCATTTGGA
AGAAGACATGAAGATCCTTTGAGTTCTACTTCCTCGTCCA
CAACAACGACCACCACCACCTCCTCTGTTACCTCACCTAC
AGGACACCGCAGCCTGCTGTCCCGGTATTGGGCAGAGGAG
AGCGCAGAGAAGGAGAAAGAGAAGGAGAAAGAGTCGGCAA
CCGTTATCCCTACAATCAACACTGCAGGCACCACCACTAC
CACATCCACCACTGGAACTGTCCTGGGCTCTGACGGGCGA
GAGAGACGCAGATCGTACCTCACTCCAGTACGAGATGAAG
AATCTGAGTCTCAGAGGAAAGCCAGATCCAGACAGGCACG
ACAGTCCAGGAGATCTACACAGGGTGTGACATTGACAGAC
CTCCAGGAGGCCGAGAAGACCATCGGTCGCAGTCGCCCCA
CACGGCCTCGAGAAGATGAAAAAGAAGAGAAGGAGAAACA
GGACAAGGAGAAACAGGAGGAGAAGAAAGAGACCGAGACC
AAGGAGGATGACTACAGGTCGCGCTATCGTAGCTTTGAAG
AGAAGTATCGCACCTCGTTGGCCTCCAGCACCACAGCGTC
CTCCACCATCCCTTCATCCTCATCCAGTAGCTCGTCTTCT
CTGTACAGCACCTCGTCTCTGAACCGACCCAACAGCCTGA
CGGGGCTCACTTCAACATACAGCCGATCTACACGCGACAC
CGACAGAGAATCTGATCGAAAAGAGAAAGATGAGGATAGA
GACGGTGATGACAAGTCTCAGCCACGCTCTATACGCGACC
GCAGACGACCTCGAGAGAAAAGACGATCCACTGGAGTGTC
CTTCTGGACCCAGGATAGCGACGAAAATGAGCCAGATCAT
CCCTCAGATTCAGAAGGCAGCACTAAAGGAGAGCCTCAGA
GCGACAGACTATCTAGCAATGACCCTCTCTCTACTAGCAC
TTCATCCACTGACCGTTATGAGTCTTTGAGTAGCCGTGGC
ATTGGGGAGAGCCGACGTCCGTACTCTCGTTTCGAAAAAG
ACGATTCCACTGATTATAAGAAGCTTTATGAGCAGATTTT
AGCTGAAAACGAGAAGCTGAAAGCTCAGTTACGCGATACA
GAATTGGAGCTGTCAGACCTAAAGCTACAGCTGGAGAAGG
CCACACAGAGACAGGAGCGCTTTGCCGATCGATCACAGCT
GGAGATGGAGAAAAGGGAAAGAAGAGCTCTAGAAAGGAAG
ATCTCTGAGATGGAGGAGGAGCTGAAGATGCTACCAGACT
TGAAAGCCGACAACCAGAGACTAAAGGATGAAAACGGAGC
GCTGATCCGAGTAATAAGCAAGCTTTCCAAATAGAGCCGA
CCCTCCGGCAGTAACGGTATTGCACATCTAGATATTAACA
CGAGACAATGGCGACAAAGAAGGCTCCGTCTCCCCCCATT
GCGTTTCCCAGCTTTCCCCTTGCTTCTCACCACACAGAAC
CACTGCGTTTATGGAACTAAGGAAAAAAAACGTTAAACGA
ACGAACGGCATCCAACACTTCATGGGCGGGAAAAAGCCTC
GAAAAACTATTTAACCAATAAGCCTTAGTTGTACATATGT
CACTCGCATCGGAAAAAAAAATTGGCTGTCACAGAACACC
AGATTTTATTTGTGCCACACTTTTCTTTTTTTCTTTTTGT
TTATTTTTTTTTCCTGTATAGATGTGGTTATGCAATGTGC
AGCTCTCTTTCCCTCGATTTCCTCTTCCTCTCCTCCAAAA
AAAAGTCGCCAAATGTCCTGCCTTTTCATCAAGGCTCTGT
CTTTCAGCAGAAGACATGGCGTTTGCTTCGCACACTTCTT
TTCATGTCCCGAAAGAGACAACGGACCTCGCTTTCACTTA
TGTGCAATATACGCATTTCTTTCGTACGCGAATGCTTTAA
GAAAGAGTCCGTCACTAGTAAACGTTCACTTGCTCTTCAC
CTCACCCCCGTTTTTTTTTTCTCCTCTTCCTCTCTCTCTC
TCTCGTTTCTCTTTGAGTTTGTAGTGTAGTCGTTGGTTTA
TATCTTGTACTCCTCACGTTGTTTTAGCAGGTACTGAGTG
AAGTTGTTGTATATACCTGTATATGTATTGTTTGAGACCA
GCACATGGCATGCGTTTATGGTTCCCCCTGTCTGTTACTA
TTGAAATATACCAACTTCAGAGGACAAAAGTGTGTTTTAA
CTACTTCCTTTCTTCTTTTATAAGTCGCGAAAAAAGTAAA
CAATAGAGGCGCCCTCTTCCTTCAGGAGGAACTTTTTTTT
TTTTTTTCGTTTCTTCTACTTCAGTTTTAAAAGTGTTCAC
CGTAATTGTGAGATGATAATATAAACGCTTCACTACATTT
CACACATTTTTATTCAGTATCTTTTTTTTTTTTTTTTGGA
AGAGTGCTGTTCAATTTTTTTGCTTTTTATTTTCTTTTGT
TTTGTTTTTTTTTTAAAGCTGTAGTATTAGCCGAGGTGTT
TGTCACTAAAAAGAAGATGCTAGTTATCGCTAACCCAATG
TCTACATGCACTGTCAGGAGTCTTAGCGAACGTTTGCCAT
CGCGTCAGATGAAGTCCATGCATCGGAAAAACTCGTTTTA
TGCATTTCAGTGGCCTTTTACTTAAAATATACTGTAGGTG
GGAAACAATGTCGCTGTAGTTGGACTGTCAGCTGTCTCCT
CTTTGGTTTAGGTTTTTAATATTTTGTTTTTGTTTTGTTT
TTTCCCCTCCTATTTTAAATTTCCCATCATCTTGTAAAAT
AGATGTGTGGCTTCATCCGTGCAAGCTGTGCTGTGACTAC
CAACCACTGAGAGTTAATTAAAATAAACTTGTACATTGTA
AAAATC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations