Transcript

tnnt3b-214

ID
ZDB-TSCRIPT-160623-663
Name
tnnt3b-214
Previous Names
  • tnnt3b-012
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000063891 (1) [ Show ] (double-click sequence to select) [Download]
>OTTDART00000063891 ZDB-TSCRIPT-160623-663 cdna:novel chromosome:VEGA67:7:39173862:39189018:1 gene:OTTDARG00000020259.4 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:tnnt3b description:troponin T type 3b (skeletal, fast)
AAGACACTCTCTTCTTTCGGCTTTTCTGAGGTCAAAAGCT
CCCTGTCATCATGTCTGATACTGAGGATGTTGGAGTCGAG
GAGTACGATGAAGAGGCCTATGAAGAGGAAGAGGAGAAGC
CAAAGTTCAAACCAAGTGCACCAAAGATCCCTGATGGAGA
TAAGGTGGACTTTGACGACATCCAGAAGAAGCGTCAGAAC
AAGGATCTCGTCGAGCTGCAGGCCCTGATTGATGCCCACT
TTGAGCACAGGAAGAAGGAGGAGGAGGAGCTTATTGCTCT
GAAAGACAGAATCGAAAAACGTAGGTCTGAGAGGGCCGAG
CAGCAGAGGATCCGTGCAGAGAAGGACAAGGAGCGCCAGG
CAAGACGCGAGGAAGAGAGGCTGAGGAAGGAGGAGGCTGA
TGCTAAGAAGAGGGCAGATGAAGATGCCAAGAAGAAGTCT
GCCTTGTCTAACATGGGCTCTCAGTACAGCAGCTACCTGC
AGAAGGCTGATTCAAAGAGGGGAGGCAAGAAGCAAACTGA
AAGGGAGAAGAAGAAGAAGATTCTGGCAGAAAGACGCAAG
CCTCTGAACATTGACCATATGAATGAGGACAAGCTGAGAG
AGAAGGCCAAAGAGCTGTGGGACTGGTTGTACTCCCTGGA
GGCTGAGAAATTCGAGCACATGGAGAAACTCAAGAGGCAG
AAGTATGAGGTCATCTCTCTCAGAAACCGCATTGATGAGT
TGCAGAAGCACTCCAAGAAGGGCGCCGCTGCTCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations