Transcript

tnnt3b-013

ID
ZDB-TSCRIPT-160623-205
Name
tnnt3b-013
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000063892 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000063892.1|ZDB-TSCRIPT-160623-205 cdna: chromosome:VEGA67:7:39180145:39181138:1 gene:OTTDARG00000020259.4 gene_biotype:protein_coding transcript_biotype:retained_intron gene_symbol:tnnt3b description:troponin T type 3b (skeletal, fast)
ATAACAAGGGTGAAAGAATATGAAATGCTGACGTTGCTCT
GTGCTTTGCTTCTTTTTGCATGAATGTGCCACACCAGTGG
ACGAAGGAGAACAAGATGGTAGTTTTTATTTCCTTCTAGA
ACAATGTCTGGATGTGCTTGTGTTTTTGGTGTGAAAGTCA
AGACCAAGTTTCTGAAGAAGTGCAATGGTTAAAAACATTT
CATCTAGCCCGCCTGCAGAGCCTAGCCAGAGGTCCACGAT
GACCAGAGATTTAGATCATGTTAGTTTCAAAAGATGGGAA
AATGAATGAAGGATAACAAGTTGAATCTTTTCCACAAGGA
TTTGTCGTTGTGTTAATTCCTGGAAGAGTGAGAATGGTCC
ATTTGTCAGGAGTTTTGTGTCTGTTTTCACTCATTCACTC
ACTTGATCTGAAGTCTTATGCAGTGATTCTTTTGTTTTGG
TTTTGATCAACTATTCTTTTCACTAACCCAGACTATTAAC
ATTACTGAAGTGAATGCGATTAATATTTACCTTAATAAGT
TACACACATATAAGCTCAGGGTAAGACTTAGAGTAACTCC
ATGTTCATGGATATGGCTAAAACAAATTCCCACTGTTTGT
TGACTAAGCGTGTTTAAAACATCTCTAACCATGTTACATA
TCCCTCTCCCTTTTTTATTTTATTGTTCACAACAGAGGAG
AAGCCAAAGTTCAAACCAAGTGCACCAAAGATCCCTGATG
GAGATAAGGTGGACTTTGACGACATCCAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations