Transcript

tnnt3b-209

ID
ZDB-TSCRIPT-090929-8023
Name
tnnt3b-209
Previous Names
  • tnnt3b-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025267 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025267|OTTDARG00000020259|ZDB-GENE-030520-2 tnnt3b|OTTDARP00000020792 tnnt3b-004 LG_ BX842701.16 Danio rerio protein_coding KNOWN, 771 bp
ACCTTACAGCCCGTCTTCGCCATCAAGACACTCTCTTCTT
TCGGCTTTTCTGAGGTCAAAAGCTCCCTGTCATCATGTCT
GATACTGAGGATGTTGGAGTCGAGGAGTACGATGAAGAGG
TAGTAGAGGTAGAGGTAGCCCCAGAGGCAGCTCCTGAACC
GGAGCCTGAGCCTGAGCCTGAGCAAGAACCAGTGCCAGAG
CCAGAACCAGAGCCAGAGCCAGAGCCAGAAAAACAGCCAG
AACCAGAACCAGAGCCAGAACCAGAACAAGAGGTGCATGA
GGAAGAGGAGAAGCCAAAGTTCAAACCAAGTGCACCAAAG
ATCCCTGATGGAGATAAGGTGGACTTTGACGACATCCAGA
AGAAGCGTCAGAACAAGGATCTCGTCGAGCTGCAGGCCCT
GATTGATGCCCACTTTGAGCACAGGAAGAAGGAGGAGGAG
GAGCTTATTGCTCTGAAAGACAGAATCGAAAAACGTAGGT
CTGAGAGGGCCGAGCAGCAGAGGATCCGTGCAGAGAAGGA
CAAGGAGCGCCAGGCAAGACGCGAGGAAGAGAGGCTGAGG
AAGGAGGAGGCTGATGCTAAGAAGAGGGCAGATGAAGATG
CCAAGAAGAAGTCTGCCTTGTCTAACATGGGCTCTCAGTA
CAGCAGCTACCTGCAGAAGGCTGATTCAAAGAGGGGAGGC
AAGAAGCAAACTGAAAGGGAGAAGAAGAAGAAGATTCTGG
CAGAAAGACGCAAGCCTCTGAACATTGACCATATGAATGA
GGACAAGCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations