Transcript

psmc3-203

ID
ZDB-TSCRIPT-160623-422
Name
psmc3-203
Previous Names
  • psmc3-003
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000063854 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000063854.1|ZDB-TSCRIPT-160623-422 cdna: chromosome:VEGA67:7:38408781:38411959:1 gene:OTTDARG00000041455.2 gene_biotype:protein_coding transcript_biotype:nonsense_mediated_decay gene_symbol:psmc3 description:proteasome 26S subunit, ATPase 3
GAAGCGGCATTTCAAGATGTCGTCGCTGAATGACAGATCA
GTTTGGGATGAGGTGGAGGATGGCATCGGAGAGGAAGTCC
TTAAGATGTCCACTGAAGAGATTGTTCAGAGGACTCGTCT
TTTGGACAATCATGAAGAGTGAGGTTCTGCGTGTCACACA
CGAGCTGCAGGCGATGAAGGACAAAATCAAGGAGAACACA
GAGAAAATCAAAGTGAACAAGACTCTGCCCTACCTCGTCT
CAAATGTCATAGAGCTGCTGGATGTAGATCCTAATGACCA
AGAGGAGGATGGAGCCAACATTGATCTGGACTCTCAGAGG
AAGGGCAAGTGTGCTGTCATCAAAACCTCCACACGGCAGA
CGTATTTCTTGCCTGTGATTGGTTTGGTGGATGCTGAGAA
ACTGAAACCTGGTGATCTGGTGGGTGTGAATAAGGACTCC
TATCTGATTTTGGAGACTCTACCCACCGAGTATGACTCTC
GTGTGAAAGCAATGGAAGTGGATGAGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations