Transcript

psmc3-202

ID
ZDB-TSCRIPT-090929-7951
Name
psmc3-202
Previous Names
  • psmc3-002
  • ottdart00000025188
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025188 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025188|OTTDARG00000041455|ZDB-GENE-030131-666 psmc3|OTTDARP00000020733 psmc3-002 LG_ BX957297.10 Danio rerio protein_coding NOVEL, 1554 bp
GAGAAGAAGCGGCATTTCAAGATGTCGTCGCTGAATGACA
GATCAGTTTGGGATGAGGTGGAGGATGGCATCGGAGAGGA
AGTCCTTAAGATGTCCACTGAAGAGATTGTTCAGAGGACT
CGTCTTTTGGACAGTGAGATTAAGATCATGAAGAGTGAGG
TTCTGCGTGTCACACACGAGCTGCAGGCGATGAAGGACAA
AATCAAGGAGAACACAGAGAAAATCAAAGTGAACAAGACT
CTGCCCTACCTCGTCTCAAATGTCATAGAGCTGCTGGATG
TAGATCCTAATGACCAAGAGGAGGATGGAGCCAACATTGA
TCTGGACTCTCAGAGGAAGGGCAAGTGTGCTGTCATCAAA
ACCTCCACACGGCAGACGTATTTCTTGCCTGTGATTGGTT
TGGTGGATGCTGAGAAACTGAAACCTGGTGATCTGGTGGG
TGTGAATAAGGACTCCTATCTGATTTTGGAGACTCTACCC
ACCGAGTATGACTCTCGTGTGAAAGCAATGGAAGTGGATG
AGAGGCCTACAGAGCAGTACAGTGACATCGGTGGCCTTGA
CAAACAAATTCAAGAGCTGGTGGAGGCGATAGTTCTGCCC
ATGAACCACAAAGAGAAATTTGAGAATCTGGGCATCCAGC
CACCAAAGGGAGTTCTTATGTACGGACCACCAGGCACAGG
AAAGACCCTGCTGGCCAGAGCCTGTGCAGCCCAAACCAAG
GCAACCTTTTTGAAGTTGGCTGGCCCTCAACTGGTCCAGA
TGTTTATTGGTGATGGTGCCAAATTGGTGCGGGATGCATT
TGCTTTGGCTAAGGAGAAGGCTCCCTCCATCATCTTCATT
GATGAGTTGGATGCTATTGGCACCAAGCGCTTTGACAGTG
AGAAGGCTGGCGACCGAGAGGTGCAAAGGACCATGCTGGA
GCTGCTCAATCAGTTAGATGGCTTCCAGCCCAACATGCAA
GTGAAGGTGATTGCTGCCACTAACAGGGTGGATATCCTGG
ACCCAGCTCTGCTTCGTTCAGGTCGTCTGGATCGTAAGAT
TGAGTTCCCTATGCCCAACGAGGAGGCTCGTGCTCGCATT
ATGCAGATCCATTCTCGCAAGATGAATGTCTGCCCTGATG
TGAACTTTGAGGAACTGGCACGATGTACTGATGACTTCAA
TGGAGCTCAGTGTAAAGCAGTTTGTGTTGAGGCTGGTATG
ATTGCGCTGCGGCGTGGGGCAACTGAGCTCAACCATGAGG
ACTACATGGAGGGCATTCTGGAGGTGCAGGCAAAGAAGAA
GGCCAATTTGCAGTACTATGCTTAAAGAGGAGGACTGTAT
GTATGTGTGTGTGTTTGTGCGTATGTGAGCATCTAACAGC
AGGATCCAGCACACCTGTAAACTTGTGCTTATCAGATCCA
GTGCTGCTCTGAGTAATGACCCGTGTTCTGATGGAGACAG
ATCAGCCAAATTAGACTGGACTGCCTCACAGTGAAGACTT
ATGGAACTTTTTTTTTCAGTTAACCTTTATGTTTGTTTCT
CAGTTCATTAAACAAAAATCTTTTTTTCACTATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations