Transcript

snrpe-203

ID
ZDB-TSCRIPT-160112-24
Name
snrpe-203
Previous Names
  • snrpe-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062331 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062331|OTTDARG00000022586| snrpe|OTTDARP00000048715 snrpe-002 LG_ BX005282.24 Danio rerio protein_coding KNOWN, 392 bp
CTTTCAGGCCAAATAGCTGCATTGAGCTCTCGCCATTAAC
CTTATTTTCAGGTATCTACAGAATCGTTCCCGAATCTCGG
TGTGGCTGTACGAACAGGTCAACATGCGGATAGAGGGTTG
CATCATCGGGTTTGATGAGTACATGAATTTGGTTTTGGAC
GATGCGGAGGAGGTTCACATGAAGACCAAAAACAGGAAGC
CCTTGGGACGGATTATGTTGAAAGGAGACAACATCACGTT
GCTGCAGAGTGTGTCCAATTGATCCACATGAATATTATTT
GTTTGCTGTTAATGTTTGTTTTCATTTCTCAATATTTGGA
TTATTGACTGACCTATAATTGTGGAAACCTTTTTGTTGTT
TTCTAAATCTCCAAAATAAACCCCTTTTTCAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations