Transcript

snrpe-201

ID
ZDB-TSCRIPT-090929-11553
Name
snrpe-201
Previous Names
  • snrpe-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029127 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029127|OTTDARG00000022586|ZDB-GENE-040426-1112 snrpe|OTTDARP00000023806 snrpe-001 LG_ BX005282.24 Danio rerio protein_coding KNOWN, 561 bp
ATCTGCGTCATTCTGTTTCCGGATTTGCGCCGCCATTGAA
ACAACAGCAGCCAACGTGAGATTTTCGTTGCCGCGCCAAT
AACTATTACACTTAATATCACATTTTGTCACTTTTTATAA
TAACATCCGGATATTATTGAGAAGAATGGCGTACAGAGGA
CAAGGACAGAAGGTTCAAAAGGTCATGGTGCAGCCCATCA
ACCTTATTTTCAGGTATCTACAGAATCGTTCCCGAATCTC
GGTGTGGCTGTACGAACAGGTCAACATGCGGATAGAGGGT
TGCATCATCGGGTTTGATGAGTACATGAATTTGGTTTTGG
ACGATGCGGAGGAGGTTCACATGAAGACCAAAAACAGGAA
GCCCTTGGGACGGATTATGTTGAAAGGAGACAACATCACG
TTGCTGCAGAGTGTGTCCAATTGATCCACATGAATATTAT
TTGTTTGCTGTTAATGTTTGTTTTCATTTCTCAATATTTG
GATTATTGACTGACCTATAATTGTGGAAACCTTTTTGTTG
TTTTCTAAATCTCCAAAATAAACCCCTTTTTCACTGTTTC
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations