ZFIN ID: ZDB-TSCRIPT-141209-967
Transcript Name: edem1-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061464 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061464|OTTDARG00000019909|ZDB-GENE-040426-808 edem1|no_translation edem1-002 LG_ BX950172.16 Danio rerio protein_coding KNOWN, 924 bp
GTTTCTTTGAGGAGGGCAGAGATGAGTATGACAGAAAGTA
CAGCTCTTTCCCGGACGCCCTTAAAGTCAAGATGAGGGCC
ATGGCGCGGGACATGTTTTATTTCGGATATGATAACTACA
TGAAGTTTGCCTTTCCAGAGGATGAACTGAACCCTATAGC
ATGTGAAGGTCGAGGGCCTGATGTGCTCAATCCGTCAAAT
ATCAACATTAATGATGTTCTTGGAAACTACTCTTTAACTC
TCATCGATACTCTTGATACACTGTTGGTTCTCGGAAATGT
GACCGAATTTCATCGAGCTGTTAAATTGGTGATTGATACA
GTATCTTTTGACAAGGACTCCACTGTTCAAGTCTTTGAGG
CCAACATCAGAATCCTTGGCAGTTTGATCTCAGCCCACAT
TCTGCTGACTGACCCACGGCACCCGTTTGGAGATGTAGGA
CTGAAAGACTATGACAATGAGCTGCTACACCTGGCACATG
ATCTTGCCGTTCGACTACTACCTGCTTTCGAGAACACTAG
CACAGGCATCCCTTATCCAAGGGTCAGGCCCGCTTGCATC
CTTTTTTATAGTGAGACGATGGCTCTTATTTCCTCTATTT
GATATTTTCTTTCTACCCTGTTTTTATGCAGGTGAATTTA
AAGAATGGTGTTCCTCCTGACAGCATTAATGAGACTTGTA
CGGCAGGGGCAGGCTCTCTGCTCGTGGAGTTTGGTATTCT
TAGCCGTCTGATTGGTGACTCTACATTTGAATGGGTCGCC
CGGCGGGCTGTTAAAGCTCTGTGGAAATTAAGAAGTAATG
AAACTGGACTATTGGGGAATGTGGTTAATATTCAGACTGG
CCAGTGGGTGGGCAAGCAGAGCGGTCTGGGCGCCGGCATG
GACTCATTTTATGAGTACCTCCTCAAGTCTTACATCTTGT
TTGG

edem1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA edem1-201 (1)    Ensembl 3365
ncRNA edem1-002 924
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
edem1-002 Contained in:
[BAC] DKEY-20F24 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000061464 (1),  Ensembl_Trans:ENSDART00000157913 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:GW711424 (1) 956 nt
CITATIONS (2)