ZFIN ID: ZDB-TSCRIPT-090929-7482
Transcript Name: edem1-201
Previous Name: edem1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024663 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024663|OTTDARG00000019909|ZDB-GENE-040426-808 edem1|OTTDARP00000047953 edem1-001 LG_ BX950172.16 Danio rerio protein_coding KNOWN, 3365 bp
GAAAGAAGAGCTGTGGACTTTTGCGCTTCGTTAAGTCGCA
GCGGCTAAGTGAATTATGACTTTGAAGGCCGACAGCAGGC
AAAGATGCAATGGAGGTCAATAGTCGTGGGTCTCCTTGTT
TTAAGAGTGCTGCTCAATTGCGCGGTGTGGCTCGTGTTTG
GACTGGGACCCAGCTGGGGCTTTGACTTCCCCATTAAATT
CACGTTCAACTCGCATAAAATTGAACTTTTCAATGATGGC
GAAAGAGCCACCGTGAAAACTAACGCCTGGTTGCGGCACC
TTTATGACAGCAGAAACCCTCAAGCGAAGACCTGCTCCAA
GATCAGCGGGAATTCGCCAAAGAAGTCCTACCTCAGTTTC
TTTGAGGAGGGCAGAGATGAGTATGACAGAAAGTACAGCT
CTTTCCCGGACGCCCTTAAAGTCAAGATGAGGGCCATGGC
GCGGGACATGTTTTATTTCGGATATGATAACTACATGAAG
TTTGCCTTTCCAGAGGATGAACTGAACCCTATAGCATGTG
AAGGTCGAGGGCCTGATGTGCTCAATCCGTCAAATATCAA
CATTAATGATGTTCTTGGAAACTACTCTTTAACTCTCATC
GATACTCTTGATACACTGTTGGTTCTCGGAAATGTGACCG
AATTTCATCGAGCTGTTAAATTGGTGATTGATACAGTATC
TTTTGACAAGGACTCCACTGTTCAAGTCTTTGAGGCCAAC
ATCAGAATCCTTGGCAGTTTGATCTCAGCCCACATTCTGC
TGACTGACCCACGGCACCCGTTTGGAGATGTAGGACTGAA
AGACTATGACAATGAGCTGCTACACCTGGCACATGATCTT
GCCGTTCGACTACTACCTGCTTTCGAGAACACTAGCACAG
GCATCCCTTATCCAAGGGTGAATTTAAAGAATGGTGTTCC
TCCTGACAGCATTAATGAGACTTGTACGGCAGGGGCAGGC
TCTCTGCTCGTGGAGTTTGGTATTCTTAGCCGTCTGATTG
GTGACTCTACATTTGAATGGGTCGCCCGGCGGGCTGTTAA
AGCTCTGTGGAAATTAAGAAGTAATGAAACTGGACTATTG
GGGAATGTGGTTAATATTCAGACTGGCCAGTGGGTGGGCA
AGCAGAGCGGTCTGGGCGCCGGCATGGACTCATTTTATGA
GTACCTCCTCAAGTCTTACATCTTGTTTGGAGAGAAAGAA
GACTTTAGGATGTTCACTGCAGCCTATGAGAGCATTCAGA
GCCACCTGAGAAGAGGAAGAGAGGCGTGTAATGAAGGAGA
AGGTGACCCACCACTCTATGTGAATGTGAACATGTTCAAC
GGACAGATCATGAACACATGGATTGACTCTCTGCAGGCAT
TCTTCCCTGGACTACAGGTTTTAAACGGAGATGTTGAAAA
TGCCATTTGCCTTCATGCCTTCTACTATGCAATCTGGAAG
CGTTTCGGTGCTCTTCCTGAGAGGTACAACTGGCAGCTTC
AGGCCCCAGATGTCCTTTTCTACCCCTTAAGACCTGAACT
AGTGGAGTCCACATACCTGCTCTATCAGGCAACCAAGAAT
CCATTTTATCTTCATGTTGGGATGGACATTCTTGAAAGCC
TTGAAAAAAATACCAAAGTGAGGTGTGGTTACGCTACTCT
TCATCATGTAGTGGATAAATCCAAAGAAGATCGCATGGAG
AGTTTCTTCCTCAGTGAAACCTGCAAATACCTTTACTTGC
TCTTTGATGAAGACAACCCACTGCACAAGTCTGAGAATAA
GTACATCTTCACTACAGAAGGCCATGTAGTTCCAATAGAT
CAGCGTTTCAGGGAGAGAAGTTGGGAAGAGCAGTTCCCAA
ATGAAGAGGCCAGGAAAGACCCAAGAGCCAACATAAGCAA
TTGTGACCGGATTCCTGAAGAGAGACGTTATGGTCTTCCA
CTAAAGAGCATGTACATGAGGCAAATAGACCACATGGTGG
GGCTGTCCTGACGTCAGTCCTGCCTCCTGTAGGTCTGACA
TACACACAAACCCCCTGGAGGTACTCAACAACTCTCCAAA
CAGAACTTTTTAGTCTCATTTTGCACATTGAGATTTTTTT
TTTATCAACAAATCAACTAGCACCAATTGTTCTTTTTTTT
GTTCCAGTGTGTCTTTTTTGTGGCATGAAAGTGTCACTCT
TAAGTTAGATCAGGTATTTGGATTTGGTTACATTTTCGGA
TCCAGCCAGCAAACATCCACAGCATAAAGCAAACTTGTTC
AGGGCAGTTCGGCTGTTCAGAATTGTAACAACAGTTATTA
TTATTATTTTTTTTATTCTTGGGCTGATTTCTATATTGTG
CAATCGAGTGTGTTTACACACCCAGTGTTACACGGTTTCT
TCAGTGCCATGTTTAATGAAACTTGATCTAGTATTACAAA
AGGGCTCTGTTGGGTGAACGAATAGTATGTTTGCATGTTT
CAGATGTTCTTCTCAAGGAACAAGCTCTTAAATAAGCTCA
TGATGACAGCTGAATCATTATACGCCTTTCAGAAACACGC
ACAACAGAGGGGCTACATTTTCTGCAAATCTCAAAAATCA
TCAAATCCACACGTTCTTTATCTTTTCATATTTTGTGCCT
TGGTTTGAAAGATGTACAACACTTATATTTTTGCATGATT
CAACATTTCCGATTGCACTGATTTCATTTTTTTTGCTATC
AGTGCATTGAGATAAATGAAAAGGTTTGGTTATGTAGCAT
ACATGTTTGGTATGTTTTGATCCAAATTAACATTGAAAAC
TGTATTTAATTAAGTGCGTTTTCCACAGCAGCTCAAACAA
GTGTTGCAATTTTCCTCTCTCTCTCTCTCTGTTAGGTCTG
GACATTTATACTAACAATAAATCCTTAAACAATATGAAGT
TTGTTGGACCAAATATTACATTTAACAAAAAAAGTGCCTT
ATTCATATTTTCATTTTCCTTCAGCGCTCAGGATTAATAG
TATGCCATAATGCAGTCACTCTGAGGTGATGTGCATGTAA
TGTGTACGTTTCTTAACTCTTTTGTTTTTATGCATATGTG
TTGTTAGTGCAAATGTTTTCTGAACAAAAGTTGACAATAA
GGGATGATCAATATGCTGGTAAGAGAAGAATTCATTTTGT
TGGTGTTATAGATCATGATTTATTTCGGGCACATAGGGAG
GATACTGTCAGTAATTACTTAGGGGGTTGTATTTATTCAG
ATTGTTTTTTATTAGATGCAGGTATTCTAATTCAAATTGT
TTCATGTTGATCTGCTTGATTTTATTGTTATTTAACCTTT
AGTCCAAATGGAGACGGAGGTTGATGTCTACACTGCATTT
TATCAAATGAAAGAAAAATAATAATAAAAACGTTACTTAA
AAAAA

edem1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA edem1-201 3365
ncRNA edem1-002 (1)    Ensembl 924
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
edem1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000024663 (1),  Ensembl_Trans:ENSDART00000147208 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC045461 (1) 3352 nt
GenBank:CA470592 (1) 846 nt
GenBank:CK239610 (1) 766 nt
GenBank:CK028610 (1) 761 nt
GenBank:CK029175 (1) 753 nt
GenBank:CN509499 (1) 742 nt
GenBank:CK708859 (1) 722 nt
GenBank:BG303491 (1) 598 nt
GenBank:AW566530 (1) 573 nt
GenBank:DT058673 (1) 572 nt
GenBank:AI545936 (1) 545 nt
CITATIONS (2)