Transcript

arid3b-201

ID
ZDB-TSCRIPT-141209-491
Name
arid3b-201
Previous Names
  • arid3b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056667 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056667|OTTDARG00000039470|ZDB-GENE-070209-182 arid3b|OTTDARP00000047601 arid3b-001 LG_none FP017193.10,CR376821.12 Danio rerio protein_coding KNOWN, 3726 bp
CTCGGTGCGCTGAGCAAAACACGCACGGTGGTTTATCTAG
GAAAAGAGAGTGATGGTGGACAATTCCAGTAGCAGCAAAG
CACAAGTGCCCAGCTTGTCTCAGGACAGCAGTCTGGCCAG
TGCGTTTTCCCAGGCAGCTTTCGCAAGTTCGGCTGGTGTC
AAACTGGAGGCAGTTATGGAGCAGCTACAGAGACAACAAC
AAGCTAAACTGGAGATGGAGCGCAAGGAAAGACACCTCAG
GGAAGCCCACATTCTGTACGCCCAGCAGCTGGCTGCACAG
CAAGCCATCATGGCCTCCGCCAGGGCCCAGGGTGCCCCTT
TAACCCCTGATTTTTACAGCAAAAACTCCAGAGACAGAGC
GCTGAAAGGTGGCCAGGGGCCTCTAGCTGCCAGGGGGCCC
GTGAAAACCGCCTCCGACCTAGCACACGAGGAGGACGCTG
CTGATGAGATGGACAGAGGAAGAGGCTCTGAGGGGGATGA
AGATGATGACGACGAGATGATGGATGGAGAAGATGGGAGT
GAAGAAGAGGAAAGCGAAGGCTTGGAGTTCCTCAGGAAGC
AAAGTCTCGCGCTTCAGCAAGCTGCTGTCGGAGTCCCTCC
ATATTCGTTCCCCGTCTACACCGCCTCACCCTCTGCTGCT
AAAAAACGTCCCTTGTCGCCGACCACTAAAGTGAAAGATG
AACCCGAAGACTCCCTCTCTGACCAGCAATCATTCAACAC
ACCAAATGGAATGGGAGATTGGAACCTAGATGACTCATTC
AAACAGAATGGAAATTCAAGTTGGAACGAAGAAGGCGATG
GTGGGAGAAGCCGAGGTGAGGCTTCCAGAGACTTTGCCAA
GCTTTACGAACTGGACAATGACCCGAAACGAAAGGAGTTC
CTCGATGACCTCTTCGCTTACATGCAGAAACGAGGTACAC
CTGTAAATCGAATCCCCATCATGGCCAAGCAGGTGTTGGA
TCTGTACATGCTGTATAAACTGGTGACTGAGAAGGGAGGC
CTGGTAGAGGTGATCAACAAGAAGATCTGGAGGGAGATCA
CCAAAGGCCTGAACCTGCCCACCTCCATCACCAGTGCCGC
CTTCACCCTCCGCACACAGTATATGAAGTACCTGTACCCG
TACGAATGTGAGAAGAAGGGTCTGAGTTCCCCTGGAGAGC
TGCAGGCGGCCATCGATAGTAACCGTAGAGAGGGCCGCCG
TCCCGGATACAGCAACAGCCTATACCGCTTCTCCCCTTCA
CCCAGCGGAGCAGCCCCTCATCTCCTCTCTCCTCCAAAAA
TGCACCTTCCCGCCACAGGACACAACGAGCTGCAGGCCAC
CCCCAGTCCTGCCCTGAAGAAAGCCACAGTCCCAGAGGAC
AGTCCAGCCTCCATGCTGCCAGCTCGTCTCCCCTTAGCCC
TGGCTCTGGGGCATCAGCAGCAGCTGGCACGTGCCGCCAC
CCTGGAGCAGCTGAGGGAGAGGCTGGAGACTGGCATGGGT
GCCGGCGCTGTGAACGCGGGGCCCGCTGTGGTCGAAGGGC
CCGAGAGGAAAATGGCGCGTCTGGCAGAGGAGCAGCAGAG
GCTACTGCAGCAGGCCTTCCAACAAAACCTGCTGGCCATG
GCATCACAGGTGAACCCCACCAACCTGAGGATGAACAACG
CCAACACCCGCGAGGAGAAGCAGGACTTGTCTCTCAGCAT
TTCTTCTAATGGCTCTGCCAGCATTACTGTGTCTGTGGAG
GTCAACGGGATTATTTACTCAGGCTCCTTGTATGCTCAGA
AGTCTGGATCCGTTCCCACCGCAGTCACCGCCATGTTCCC
AGGCCACACTTCCACCCTCAGTCCCGGCGTGGCCTCTTCA
TCCTCCTCTTCCTCCTCAAAGGGTCCTGACTCTGTGGATC
CAGCCACAGGCGGGTCACCCTAACCAGCACCAACACCTCC
CAAAACCTGTTACCAAAAACAACCCTGCCAGTCCAGCCCA
AAACTACTGTCATTTCCAGTGGAGCGCATGAGCCGTTCTG
CCCTCTAGAGGTGGTTTGATGAATCACAATCTGCCTCCAG
CACAAGCGCGCAGCTGTGTTTTCCTTCCAGCCAAAAGGAG
GGACCACACACACAGACACTTTTACAAACTCCTCAGCTGT
TCAAGCTCGTCACGGACCCCACCGGCTCTTTTCTACATGA
TGTTTTTTCTCAGGTTTTTAGAGATGTTCGATTCAACAAA
ATACCTCAGCTGTCTTAATCTCAGTGCTGTCGTGAGTGTG
GGTTTAATCATGCCTTTAATCACGCACCCATAGTCATTCA
CTCACTAAAGATCTGTGAAGCTAACCGTGGCATGATCAAA
TCTACTTCTGCCAAAGTCACATTTTTGTGAGGAGGTTGTG
GTTGACAGTCTTTCTTTCGTTCTCTCTCTCTTTCTCTCTC
TCTGGCTTTTGCTGTCTATTAATTCTCTTATTTAAAGTTT
GCTGAATTTACCTCATCTGCAGTGAATTTAAAAGACTCAG
GATCGATTATGATACTGCTGTGTTATTGTTTTGTTTTGTT
TTTGGTTTAAAAAAACTTCAGGCTTCAATCCCCGTCAAGT
GTTGGAAAGGTGGTTTGGTTAGAAAAGGGGTCAGATTATA
ATTTTTTTTTTATTATTATTATTGTATTTACTTGATTTTA
TTTGTTTTCTATTTTCCATTTGTTTTTTAGCTACTAGATA
CAGAAATATTAATAAGATTTGAAAGAGTTTTTGAGTTTGA
AATTGCATTTTACACAGCTGAGAGTTTCTTTTTGTTTGTT
TATTATTATTATTTAGACATATTTACAGGCAACAGTTTGG
TTGAAAGATTTTTCTCTACCTCAGACACAAGACAATGTAT
GGTTGAAAGGAAATTATTGTGGACGCGAAGGGTTCGTGTC
GCACGTCAATCATTTCTGTGCGTCGGACGATCATGTACAG
GCTCGTGATGAAATAAGAGCCGTAGTAATGTACCATTCTT
TAAAACAAACCAGGTCACGGAAAAAAGCAGGATAACATTC
GAATCAAACGAAGATTGGATGGCTTTTTTTTCATTTTGTA
TTTTTAGTTGTTGAACTTCAGACCTCACATATCTTTCCAT
ATTGGAAAGCGAGTTTCTCAGGAATTTTTTTTCTTCATAA
CTTTTAATCTTCAGAACCTAGATGCAGTCTCGCTCCTGAA
ACGAATGACACTAGACGTAACTCGGTCGCCGTGGGACTGA
AATAGCTACCTCACTTAGGATTTACCTCGGATGTAGTTCA
ACTACTTGCAGTACAACACAGAATTACCTCAGACGTGTAC
TGCTGGCTGTCTTTTCAAGCGAAAGAAATCACTCAGGTAA
AGAATTAGCAAAATACCTCAGAAAAGGCAGAATAGCGTTA
ATACAGCAGTGCGAGATGAGATTGTCGTATGAAGAGTTAG
ATCTCATATCCATGATGTATTGATTAGTGCAGAAACTGTC
TTCCAGTAGCAATGGAGGCTCGTTGGCTTGGTTATGTTGG
TGTAGTCTTGCCGACGTAGCCTCATCAACTGTACATTTTA
GCCGTTTATAATCCTGCGTTTTGCTTGACCCTGGGACCTG
CTGGGATTCAGACATTTATTAGTTTCTTCGGTTTTACGTT
CTATATTCTTCAGATTTCTGCATAGCTAAGAACCAAAGAC
CATGTGTTTGTTATCCTCTCTGATGACCTTACTGTATAGA
CACATGCAACTTTACACAACGAAATTAAAGTCTGATCTGA
TGCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations