Transcript

arid3b-202

ID
ZDB-TSCRIPT-141209-1719
Name
arid3b-202
Previous Names
  • arid3b-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056668 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056668|OTTDARG00000039470|ZDB-GENE-070209-182 arid3b|OTTDARP00000044446 arid3b-002 LG_none FP017193.10,CR376821.12 Danio rerio protein_coding KNOWN, 532 bp
GCTGTCGGAGTCCCTCCATATTCGTTCCCCGTCTACACCG
CCTCACCCTCTGCTGCTAAAAAACGTCCCTTGTCGCCGAC
CACTAAAGTGAAAGATGAACCCGAAGACTCCCTCTCTGAC
CAGCAATCATTCAACACACCAAATGGAATGGGAGATTGGA
ACCTAGATGACTCATTCAAACAGAGGCAACAAACTTTTGC
AAATGGGAGACCTTAGCAGAGTCCTAAAAACAGGTTGCCC
AATCTAATGTGCAGTTAAAGGAACAAGCTCACGACACCAA
CCTCATTTATAGCAGTGTTACACTATAATCATCCTCTTGA
TAATGCTTTGTCAGATCGCCCTGCTCTTCTGAAGTAATTC
ACAAGTTAGTCCTGATGTCGTATCTCCTCCGGAAATGAAA
GTGACTTGGTTTACAAGTTTGTGGGGTGTTTTGAGTAGTT
GTTGTCATGTGACATGTTTTTGACATGATGGCTGTGCCTC
ACGTTTGTTACATACAAACTACAAAACCAAAATAAACTTT
TGTTTTCAAGTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations