Transcript

pitx3-202

ID
ZDB-TSCRIPT-141209-3145
Name
pitx3-202
Previous Names
  • pitx3-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060557 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060557|OTTDARG00000020663|ZDB-GENE-041229-4 pitx3|OTTDARP00000047842 pitx3-002 LG_ CR626878.14 Danio rerio protein_coding KNOWN, 884 bp
TGCAGTTTCATGAAGACCATGAATAGAGCCTGGCGGTAGA
GGTGATGGATTTTAACCTTCTAACGGACAGTGAGGCCCGC
AGCCCGGCACTGTCTCTGTCTGACTCCGGGACTCCTCAGC
ACGACCCGGGATGCAAAGGCCAAGACAACAGTGACACAGA
GAAGTCCCATCAGAACCACACAGATGAGTCGAACCCAGAG
GACGGCTCTCTAAAGAAAAAACAGCGCCGGCAAAGGACAC
ATTTCACTAGCCAGCAGCTCCAGGAACTGGAAGCCACCTT
TCAGAGAAACCGTTATCCCGACATGAGCACGCGAGAGGAG
ATTGCGGTGTGGACCAACCTCACAGAAGCAAGAGTACGGG
TGTGGTTTAAAAACCGCCGAGCCAAATGGAGAAAGCGAGA
AAGGAACCAGCAAGCCGAGCTGTGCAAGAACGGCTTCGGC
GCCCAGTTCAATGGACTCATGCAGCCGTATGACGACATGT
ACTCTGGCTACTCCTACAACAACTGGGCCACTAAGAGCCT
GGCCAGCAGTCCGCTGTCAGCCAAAAGCTTTCCTTTCTTT
AACTCCATGAATGTAAGCCCGCTGTCCTCCCAGCCAATGT
TCTCCCCGCCCAGCTCCATCCCTTCCATGAACATGGCCTC
ATCGATGGTGCCCTCGGCGGTGGCAGGGGTGCCGGGCTCA
GGCCTTAACAACCTGGGAAACCTGAACAACCTGAACAGCC
CCACCCTCAATTCTGCAGCCGTGTCAGCAGCCGCCTGCCC
GTATGCCACCACGGCCGGTCCATACATGTACAGAGACACC
TGTAACTCCAGTCTGGCCAGCCTCCGGCTCAAGGCCAAAC
AGCACGCCAACTTCGCCTACCCGGCAGTGCAGAACCCTGT
TTCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations