Transcript

pitx3-201

ID
ZDB-TSCRIPT-090929-8638
Name
pitx3-201
Previous Names
  • pitx3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025934 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025934|OTTDARG00000020663|ZDB-GENE-041229-4 pitx3|OTTDARP00000047843 pitx3-001 LG_ CR626878.14 Danio rerio protein_coding KNOWN, 1865 bp
GGGGATCCAGCCTTCACTCTCCGCTAAAAACTTATGACAG
ACAACACACACAGAGAGAGAGAGAAAGGGGAAACTGACTC
TTTACGTTTGCTCATCTTAAGGAACTTTCTACATGACCAC
TGCATCGTTTCAGAAAAGCTGCTAAGACGCGTTGTACACA
AAAAAGTTGTACCTTTTTCGAGGATTACCTCCACTAGACC
GGGATTCATAGCCTGGCGGTAGAGGTGATGGATTTTAACC
TTCTAACGGACAGTGAGGCCCGCAGCCCGGCACTGTCTCT
GTCTGACTCCGGGACTCCTCAGCACGACCCGGGATGCAAA
GGCCAAGACAACAGTGACACAGAGAAGTCCCATCAGAACC
ACACAGATGAGTCGAACCCAGAGGACGGCTCTCTAAAGAA
AAAACAGCGCCGGCAAAGGACACATTTCACTAGCCAGCAG
CTCCAGGAACTGGAAGCCACCTTTCAGAGAAACCGTTATC
CCGACATGAGCACGCGAGAGGAGATTGCGGTGTGGACCAA
CCTCACAGAAGCAAGAGTACGGGTGTGGTTTAAAAACCGC
CGAGCCAAATGGAGAAAGCGAGAAAGGAACCAGCAAGCCG
AGCTGTGCAAGAACGGCTTCGGCGCCCAGTTCAATGGACT
CATGCAGCCGTATGACGACATGTACTCTGGCTACTCCTAC
AACAACTGGGCCACTAAGAGCCTGGCCAGCAGTCCGCTGT
CAGCCAAAAGCTTTCCTTTCTTTAACTCCATGAATGTAAG
CCCGCTGTCCTCCCAGCCAATGTTCTCCCCGCCCAGCTCC
ATCCCTTCCATGAACATGGCCTCATCGATGGTGCCCTCGG
CGGTGGCAGGGGTGCCGGGCTCAGGCCTTAACAACCTGGG
AAACCTGAACAACCTGAACAGCCCCACCCTCAATTCTGCA
GCCGTGTCAGCAGCCGCCTGCCCGTATGCCACCACGGCCG
GTCCATACATGTACAGAGACACCTGTAACTCCAGTCTGGC
CAGCCTCCGGCTCAAGGCCAAACAGCACGCCAACTTCGCC
TACCCGGCAGTGCAGAACCCTGTTTCCAACTTAAGCCCCT
GCCAGTACGCTGTGGACCGGCCGGTATGAAAGCGATGCGT
CTAGATTTCGAAAAAAACAAACAAACCCCGACACGAACTT
CAAGCCCTTGTCTAGCCAACCCTACATTCGACTCTGAGGC
ATCATCACCCTACAATGAACTGGATTTCTGGGAATAAAGC
TTCACGAGGAATGGAGCGTCACAATGGACCAGGCCTCAAA
GAACTCATGCGATAACATGTTAAGACGCTGTCGCCGAACC
GACCAACTGTTTAAAAGCTTTTGTCCGCTGCATGATTAGA
GACAAAAGAGGACGTAAACACTTCCGCTGCACTCAGACCT
CCCGAAAGAATATCATAGGCAGAGATAAGAGGATGTACAT
AATGGACTCTGTATTGTATGTGATAAAATATCTCGGAAAT
GTAGTATTTTAACGATGAGAGGAGCATGTTCCTCAACAGT
GGAGGATGGACCTCCGCGAGGAATTTTAATCTTTGTTGTG
AATTCCATTCACCTAAGGTCAGAGGTCAAAGGTTGTTGTA
AGATGACGAGACAAAACCTAGCATTGAGTAGTTTCAGATG
AAAAGAGAGAGAAAAAACAATGAAAATTGGGACTTTTTTA
TTTTAAACGATGAACTAAAAAGCCATTGAGTAAATAGATT
TGTGTGGTGTTTAAAAAAAGGGAGTCTATGACTGTAATAT
AATGTATGTAAGAGTGCAGTTGTTATAAAACAAGCTTTTT
TTCCTGGTGTAGCCTGCTTTGTCTCATTAAAAATGAAATA
AATAATTATTTGTTTTTATGAACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations