Transcript

ndufs7-002

ID
ZDB-TSCRIPT-141209-3054
Name
ndufs7-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060223 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060223|OTTDARG00000041788|ZDB-GENE-041111-261 ndufs7|no_translation ndufs7-002 LG_ BX323045.14 Danio rerio protein_coding KNOWN, 849 bp
AGTGGATGATATGGAAAAATGGCGGCGCTGATGGTTCCCC
GCCTTCCAGCACTTGGCTCTTTTAATTTAAGGGCCTTTTC
ATCATTTTCTGCTCATAAAAAGCTTCTTCCGACAGACTGC
AAAGATGAAAACTCCTCATGTCTGGTCCCATTCAGAGAGA
AAAGCACAGCTCTGGCAGCAAAACCAGCTTCAGCCGTGAG
CAGCAAGGGGGAGTACGTCATCACCAAGCTGGATGATCTG
GTCAACTGGGCGCGCAGAAGCTCCTTATGGCCCATGACGT
TTGGCCTGGCGTGCTGTGCAGTAGAGATGATGCACATGGC
CGCCCCGCGCTATGACATGGATCGCTTCGGTGTCGTGTTC
AGAGCCAGTCCCAGACAGGCTGATGTCATGATCGTAGCTG
GGACACTCACCAATAAAATGGCTCCTGCATTGCGGAAGGT
ATTGGTGCCAGTTCAGTTTTAGCAAACTTCCATTTGACCA
GTGGTTTTCAGTTTCGGTCCTCGCCCTGAAATTTATTAAG
GGTGCACAAATATGTAGTTTCAGCATCTTTATCACAATGT
GTAAATCTGCAATAGTCACATCCCAGAATCAGCAATGTCA
AGTTGGAATTATGGTTGATTAATTTGTGGGGTCATCACAA
AGTTTAACCCTGAAGTGTTGTGAAAGTTTTTTTAAACTGT
AATGCTGTGTTCACACCAGACGCGGAACGCGTGGATAAAT
TGCGCTTAAATAGCTGCGTGAACATTTGAGTTTACTCGCT
TCATACGCGCGTCAAACCCCGCTTCATTTGCGTGTCAAAC
CCCGCTTCATTTGCGTGTCAAACCCCGCTTCATTCGCGTG
TCAAACCCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations