Transcript

ndufs7-202

ID
ZDB-TSCRIPT-141209-1834
Name
ndufs7-202
Previous Names
  • ndufs7-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060222 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060222|OTTDARG00000041788|ZDB-GENE-041111-261 ndufs7|OTTDARP00000046538 ndufs7-003 LG_ BX323045.14 Danio rerio protein_coding KNOWN, 884 bp
CGGGTCACGACGGAAGTGGATGATATGGAAAAATGGCGGC
GCTGATGGGACTTCAGCCGCTGACCTTGTTATTCAACATG
ACGAAACTAAGACTGACTGACAGATACAAACAACTCCGAT
TATTTGCAGAACAAATTCCCCGCCTTCCAGCACTTGGCTC
TTTTAATTTAAGGGCCTTTTCATCATTTTCTGCTCATAAA
AAGCTTCTTCCGACAGACTGCAAAGATGAAAACTCCTCAT
GTCTGGTCCCATTCAGAGAGAAAAGCACAGCTCTGGCAGC
AAAACCAGCTTCAGCCGTGAGCAGCAAGGGGGAGTACGTC
ATCACCAAGCTGGATGATCTGGTCAACTGGGCGCGCAGAA
GCTCCTTATGGCCCATGACGTTTGGCCTGGCGTGCTGTGC
AGTAGAGATGATGCACATGGCCGCCCCGCGCTATGACATG
GATCGCTTCGGTGTCGTGTTCAGAGCCAGTCCCAGACAGG
CTGATGTCATGATCGTAGCTGGGACACTCACCAATAAAAT
GGCTCCTGCATTGCGGAAGGTGTATGATCAAATGCCAGAG
CCCAGATACGTCATTTCCATGGGAAGCTGTGCTAATGGAG
GTGGCTACTATCACTACTCTTATTCGGTGGTCCGTGGTTG
TGATCGCATTGTTCCAGTGGACATCTACGTCCCAGGTTGT
CCTCCTACAGCAGAGGCTCTGCTTTATGGAACGCTGCAGT
TGCAGAGGAAGATCAAGCGGGAGAAGAGAATGAAAATTTG
GTATCGCAAGTGAGCTGTGATTCTGTCTGTGTGTCTGTTC
TGAAATGTATATTTAATAATGGTCATTTGTTGTGCTCGGA
AGGCTGATTTCTCTGGAGCTGCTCTGGTTTGAGTCCAGCT
CCTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations