ZFIN ID: ZDB-TSCRIPT-141209-2727
Transcript Name: sem1-202
Previous Name: shfm1-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049242 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049242|OTTDARG00000034730|ZDB-GENE-030131-988 shfm1|OTTDARP00000038641 shfm1-003 LG_ CU634012.11 Danio rerio protein_coding KNOWN, 644 bp
GTTCATAACGTCGAGTGTCCACGCTGTTCACAGAAACACA
ACATGTCAGAAAAGAAGCAAACAGTGGATTTGGGGCTTTT
GGAGGAGGATGATGAATTTGAGGAATTCCCAGCAGAGGAC
TGGACGGGCCTGGATGAAGATGAGGATGCTCATGTTTGGG
AAGATAACTGGGATGACGACAACGTAGAGGATGACTTTTC
TAATCAGCTGAGGTAGGAGATGCATTATCAATGTATAAAT
TATGTATATGAAATACGGGGCATGCTTTATTGTTGCACTA
AATAAGGAGTATACTAGTTTAATCTAACTTCACAGTATGC
AATTCCTGGTAAACATTATGGTGTTCTAGTGTCTCTTATA
ATCTGCTAGCATATTAACTTTCTGTCAAGCCCACATTTTG
TCTAAAGAATTTGGTGTGGTTAAACTAATTTAGAAGAAAA
CCCTCCCTAAGGGAACTAATAGTCCAATGGCTAACCGACA
TTCATGGTGGCCTCAAACCACATTCACAAACTTTACTATC
TGTGAGGACTTGGCCCAAGTACATACAGGCATTTAATATG
CTTACATAGATGTTTAAAAGTATAAAATATAAGAGTAAGT
TGCTATGTTATATAGTTTATGCTTCCTATCAAGGTTATTA
TAAT

sem1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA sem1-201 (1) 1475
sem1-202 644
sem1-203 (1) 358
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sem1-202 Contained in:
[Fosmid] CH1073-274G5 (1) (order this)
OTHER sem1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049242 (1)
  • Ensembl_Trans:ENSDART00000167772 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB900615 (1) 644bp
    GenBank:EB830978 (1) 425bp
    CITATIONS (2)