header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-1508
Transcript Name: sem1-203
Previous Name: shfm1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049241 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049241|OTTDARG00000034730|ZDB-GENE-030131-988 shfm1|OTTDARP00000038640 shfm1-002 LG_ CU634012.11 Danio rerio protein_coding KNOWN, 358 bp
CAACTTATCCAGCATATGTTTTACGCAGCGGATCCCCTTG
CAGCTGCAAGCCATCATAAGCTAAATTGGCGGTAGTACAT
GTGTGTGAATGGGAGTGTATAAGTGTTTCCCAGTGATGGG
TTGCAGCTGTAAGCGCATCCGCTGCGTAAAGCATGTGCTG
AATCAGTTGGCGAAACACAACATGTCAGAAAAGAAGCAAA
CAGTGGATTTGGGGCTTTTGGAGGAGGATGATGAATTTGA
GGAATTCCCAGCAGAGGACTGGACGGGCCTGGATGAAGAT
GAGGATGCTCATGTTTGGGAAGATAACTGGGATGACGACA
ACGTAGAGGATGACTTTTCTAATCAGCTGAGAGCGGAG

sem1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA sem1-201 (1) 1475
sem1-202 (1) 644
sem1-203 358
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sem1-203 Contained in:
[Fosmid] CH1073-274G5 (1) (order this)

OTHER sem1-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049241 (1)
  • Ensembl_Trans:ENSDART00000172350 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BM025967 (1) 510 bp
    GenBank:BM026209 (1) 393 bp
    CITATIONS (2)