Transcript

btr01-203

ID
ZDB-TSCRIPT-141209-2725
Name
btr01-203
Previous Names
  • btr01-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000048577 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048577|OTTDARG00000034343|ZDB-GENE-090511-2 btr01|OTTDARP00000038103 btr01-002 LG_ CU929294.7 Danio rerio protein_coding NOVEL, 379 bp
CCACACTAGTTTACCAGTGATGAAGAGCTGGGCAGAGGTG
GCTCTGACTCCTGACCCCACGGCAGGCGTGGTGCTAAGAA
ACGTCTCTCAGATGGTGGAGGAGGTTCGACAAGGCCTGAG
GAGACTCTCGGAGATCTGTTTGCACCCTTCCACAGAAAGA
TCGCTGGGAGTGTATCAACAAAGTGTGTGGAGAGCACCAG
GATTTGCAATGGACGTGACCCTAGACAAAGACTCGGCTCA
CCCCCGTCTGGTCATCTCGGAGGATGGGAAGCAGGTGCTG
TGCAGTGACCGATACCAGAATGTGCCAGACACACTCGAGC
GATTCGACCGTGTGGTGTGTGTTCTGGGCCGCCAAGGTAT
CAACTCCGGCTGCCATTAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations