Transcript

btr01-202

ID
ZDB-TSCRIPT-141209-1505
Name
btr01-202
Previous Names
  • btr01-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000048576 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048576|OTTDARG00000034343|ZDB-GENE-090511-2 btr01|OTTDARP00000038102 btr01-001 LG_ CU929294.7 Danio rerio protein_coding NOVEL, 448 bp
ACTTCATAGTGAAGCTGTCCTACACGACATACATTGAGAG
GAGCTGAACGCAGCCCAAAAACAACATCAGGGAAAAGCAA
AGCACAGACAAGAGGTGTACGATGTCATTTCCTGGTGAAT
TCCTGTCAGAGGAGCAGTTCACCTGTTCCATATGTCTCGA
CATCTTCACCAATCCCGTCTCCACGCCCTGCGGCCACAGC
TTCTGCTCCTCGTGCATTTCCTCCTACTGGGAGGGCCAAG
GAAAGACTTGCTTCTGCCCTCTGTGCAAAGAAAGCTTCCG
TAAGCGCCCCGAGCTCCACGTCAATCACACGCTCAAGGAG
ATCACGGAGCAGTTCAAGCGGATGGCCGAGACCACAGTGA
GCGTGCCTAAAACTGCAACAACAGATTCACCTCCAAACCC
ATTCTCTGCCCAGAAGCCTGGAGTGCAGCAAAGACCGGTT
GAGCTGCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations