Transcript

skiv2l2-002

ID
ZDB-TSCRIPT-141209-2657
Name
skiv2l2-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044857 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044857|OTTDARG00000032161|ZDB-GENE-040426-2854 skiv2l2|no_translation skiv2l2-002 LG_ CU929245.4 Danio rerio protein_coding KNOWN, 535 bp
CAGTGCAGATGAGCTGCTGCTGACAGAGATGATGTTTAAC
GGCTTGTTCAATGACCTGACGGCGGAGCAGGCCACCGCTC
TCCTCAGCTGCTTCGTCTTCCAGGAAAACGCCAACGAGAT
GCCCAAACTGACAGAGCAGCTGGGCGGTCCACTGAGACAG
ATGCAGGAATGTGCCAAGAGAATTGCTAAAGTGTCTGCAG
AGGCCAAGCTGGAAGTGGACGAGGACAGTTACCTGAACCA
GTTCCGTCCGCACCTGATGGATGTGGTCTACACCTGGGCC
AATGGCTCTTCTTTCTCTCAGATTTGCAAAATGACAGACG
TGTTTGAAGGTAATGGCTCCCAACAAAAACTACTGGATCT
GTTTGATTCATTGTGCAATACCTCTAGCTTAAATATCACA
CATTTTCCAATGTATTTATGATTCAATTTAAACCAGTAAT
TTTTTTGAAGGCACTTTTTATCCATAGTTCCCAAAAATGG
CTTATTTTCGTACCCCATGTTTCCCAGAAATGAACAAATG
CAATTAGTTTGGAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations