Transcript

mtrex-201

ID
ZDB-TSCRIPT-141209-1441
Name
mtrex-201
Previous Names
  • skiv2l2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044856 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044856|OTTDARG00000032161|ZDB-GENE-040426-2854 skiv2l2|OTTDARP00000035491 skiv2l2-001 LG_ CU929245.4 Danio rerio protein_coding KNOWN, 3333 bp
CGCGGCCTGCGCATCGCACTCTGGGATTTGTGTCTGTTTG
AAGACATGGCGGACGCCTTTGGAGACGATTTGTTCAGCGT
GTTTGATGAAGAACAGGCCGGTTCCAGCAAAAAGGCCGCT
CCAAAGTCCGCAGCTAATGCAGGGAAAACGCCTGATAAAG
CTGGCAAACCACAGGGAGATTCAGCATCTTTGCGCAAAAG
AGATGCTGATGATGATGGTCCTGATGAGATGCTGCTGGGG
AAAAGGCAAAAGCTGGAAACGGTGTCAGCGGAGGAGATCA
ATCTGTCAGAGCTTATGCCGAAAGTGAAATCAGAGCAGGT
GGAGACAGTGGAGGGCTGCACTCATGAGGTGGTTCTTCCT
GCCAATGAGGAATACACTCCGCTGAAACCACGTGTTGGAA
AAGCTGCCAAGGAGTATCCCTTCATACTCGACCCTTTCCA
GCGCGAGGCCATCCTGTGCATCGATAACAACCAGTCTGTG
CTTGTGTCGGCCCACACGTCAGCAGGAAAGACCGTGTGTG
CCGAGTATGCCATTGCTCTGGCACTCAGAGAAAAGCAGCG
TGTCATCTTCACCAGCCCCATCAAAGCTCTGAGCAACCAA
AAGTACAGAGAGATGTACGAGGAGTTTCAGGATGTGGGGC
TGATGACCGGTGATGTCACTATTAACCCCACTGCTTCCTG
TCTGGTCATGACCACAGAGATTTTGAGGAGCATGCTGTAC
AGGGGGTCAGAGGTCATGAGGGAGGTGGCATGGGTCATCT
TTGATGAGATCCATTACATGAGAGACTCAGAACGTGGCGT
GGTCTGGGAAGAGACCATCATCCTGCTGCCAGATAATGTA
CACCATGTTTTCCTTTCTGCCACCATTCCTAATGCTAGAC
AGTTCGCAGAGTGGATTTGTCACCTCCACAAACAGCCTTG
TCACGTGGTGTACACAGACTACCGTCCCACTCCACTGCAG
CACTACATCTTTCCAGCAGGGGGCGATGGACTCCATCTTG
TCGTGGATGAGAACGGAGAGTTTAGAGAAGACAATTTTAA
CACCGCAATGCAGGTCCTTAGGGATGCGGGGGACACAGGA
GGCAACACTGGGGCCAAATGGGACCCCAAAGGCAGAAAAG
GTGGAACAAAAGGTCCATCTAACGTCTTCAAGATCGTGAA
GATGATTATGGAGAGGAACTTCCAGCCGGTGATCATCTTC
AGCTTCAGTAAGAAAGAGTGTGAGGCCTATGCTCTGCAAG
TCTCCAAACTGGATTTCAACACAGACGAAGAGAAAAAACT
GGTAGAAGAAGTGTTCAACAATGCCACAGACTGCCTCTCT
GATGAGGACAAAAAACTGCCACAGGTGGAGCATGTGTTGC
CGCTGCTCAAGAGAGGAATAGGCATTCATCATGGTGGCCT
CTTGCCCATCCTGAAGGAGACCATTGAGATCCTCTTTTCT
GAGGGGCTGCTGAAGGCCTTATTCGCTACAGAAACATTTG
CCATGGGGATCAACATGCCTGCGCGAACCGTTCTCTTCAC
CAGTGCTCGAAAATTCGACGGCAAAGACTTCCGCTGGATC
TCCTCTGGAGAGTATATCCAGATGTCAGGACGTGCCGGCA
GAAGAGGAATGGACGAAAGGGGAATCGTCATATTCATGGT
TGATGAGAAGATGAGCCCTGCAGTCGGCAAACAATTACTG
AAGGGTTCAGCAGATCCTCTGAACAGTGCGTTTCACCTGA
CCTACAACATGGTGCTCAATCTGCTGCGTGTGGAGGAGAT
CAACCCAGAGTACATGCTGGAGAAATCCTTTTACCAGTTC
CAGCACTACAGAGCCGTGCCTGGCGTTGTGGATAGGATGA
AAAAGCTGGAGGAGGAATATAACGCCATACGAATCCCCAA
GGAGGAGAGCGTGGTGACCTACTACAAGATTCGCCAACAG
TTGGCCAAATTGGGCAAAGAAATCGAGGAGTTTATTCACA
AACCCAGATACTGCCTGCCCTTCTTACAGCCAGGCAGACT
GGTCAAGGTAAAAAAAGAAGATCTGGATTTTGGTTGGGGT
GTAGTCGTCAATTTCCAAAAGAAGTCAAATGTCAAGGCTG
GCGGTGACCTTGATCCACTGTTTGTGGTGGAAGTTCTGGT
TCACTGCAGTAAAGACAGCGTGAAGAACGCCGCCACGGAG
TCAGCCAGACCCGCTGGCCCTGCAGAGAAGGGAGAGATGC
AGGTCGTTCCTGTGATTCTTCATCTCATCACCTCTATTAG
TTCTGTGCGCCTCTACATCCCTAAAGACCTGCGGCCCTAT
GATAACCGGCAGAGCATGCTCAAATCCATACAGGAGGTGC
AGAAACGTTTCCCAGATGGGATACCGTTGCTGGATCCCAT
AGATGACATGGGAATCAAGGATCCCGCCCTGAAGAAGGTC
ATCCAGAAGGTGGAGGCATTCGAGCACAGGATGTACACGC
ACCCGCTGCACAGCGACCCCAACCTGGAGGCCGTTTACAA
ACTCTGTGAGAAGAAAGCGCTGATTGCGGGTGATATTAAA
GCAGCAAAGCGAGAGCTAAAGAAAGCCCGCACCGTGTTGC
AGATGGATGAGTTGAAGTGCAGAAAGCGTGTGCTGCGCCG
ACTGGGATTCGCTACTTCCTCTGATGTCATCGAGATGAAG
GGCCGTGTGGCATGCGAGATCAGCAGTGCAGATGAGCTGC
TGCTGACAGAGATGATGTTTAACGGCTTGTTCAATGACCT
GACGGCGGAGCAGGCCACCGCTCTCCTCAGCTGCTTCGTC
TTCCAGGAAAACGCCAACGAGATGCCCAAACTGACAGAGC
AGCTGGGCGGTCCACTGAGACAGATGCAGGAATGTGCCAA
GAGAATTGCTAAAGTGTCTGCAGAGGCCAAGCTGGAAGTG
GACGAGGACAGTTACCTGAACCAGTTCCGTCCGCACCTGA
TGGATGTGGTCTACACCTGGGCCAATGGCTCTTCTTTCTC
TCAGATTTGCAAAATGACAGACGTGTTTGAAGGCAGTATT
ATCCGCTGTATGCGCAGACTGGAGGAGCTCTTAAGGCAGA
TGTGCCAGGCAGCTAAGGCCATTGGAAACACAGAGTTGGA
GAATAAGTTTGCAACCGGTATAACGAAGATTAAGAGGGAT
ATCGTGTTTGCTGCAAGTCTATACCTCTAAATCCTAAGAC
TCCTTTTTTTTGGATGTTATTTTTGCATAAAAACACAGCA
GGAGAGCAGAGACATGGAACATAATTGTTTTATTTGTGTT
CGTCAACGAGCATAATGGATTTTTGTTTTCGTCATAAAAG
CGCAACATTATTGTACATACAATTTTAACAATTTTAATAA
AAAAAAGTCTGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations