ZFIN ID: ZDB-TSCRIPT-141209-2552
Transcript Name: zgc:163098-203
Previous Names: dkey-17o15.1-002, zgc:163098-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030264 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030264|OTTDARG00000023259|ZDB-GENE-070410-141 zgc:163098|OTTDARP00000024663 DKEY-17O15.1-002 LG_ BX927261.8 Danio rerio protein_coding NOVEL, 812 bp
ATGCACACAGGCTGTTTCTCCCAATCTAGTGAGCTACACA
CAGACAGCTATTTGGGAGACTGTAGGCGCCTGTGATACCC
ACAATTGCTGTCTTGGTAGTCAGTTTACTAGGTTTGCAGA
CTTGGTTTTAGAGACACCACCAATTGCAGAGCTGACATGG
CAGACAAAAAAGGGAAATCTGTGGCGGTGAAGAGGACACT
AACAAAAAAAGAACAAGAGGAAATGAAGAAAAAGGAGGAG
GAGAAAGCTGCTGAAGTCTTTGAGGAATTTTTAGCTGCTT
TTGACACTAATGACAAAAGTGGAGTAAAGACATTTGTACG
AGGAGGTATTGTAAATGCAACTAAAGAGGAAGAAGCCGCA
GAGGTGAAGAAGAGCAAACTCTACAGACCCTCGGCTAAAT
TCTCTGCTCCACTTCAGAATACCTCACCTGTTCACCATGC
AGAAGTTAAAAAAGCTGTTGCTAAAAAGAAAGTGGAGGAG
AAGAAGAAGAGTAATCTTGAGCTTTTTAAAGAGGAGTTAA
AACAGATACAGGAGGAAAGAGAGGAGCGATACAAAAGGAA
GAAAGGCGACTCTGGAGCAGTTTTTTTAGGAGATCTAGAA
CCTCTGACACGAAGATCAATATTTGATGATGATCCTGCAG
TGCCAAACACAACAAACCTTTACATCGGCTGCATCAACCC
CAAGATGACAGAGGAGATGCTGTGTAAGGAGTTTGGGAAA
TACGGTCCTCTGGCCAGTGTAAAGATCATGTGGCCTCGCA
CTGAGGAGGAGAGAACAAGAGTCACCAACCGTGGTTTTGT
TGCTTTTATGAC

zgc:163098 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:163098-201 (1)    Ensembl 3117
zgc:163098-203 812
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:163098-203 Contained in:
[BAC] DKEY-17O15 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000030264 (1),  Ensembl_Trans:ENSDART00000122919 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CV107704 (1) 819 bp
CITATIONS (2)