header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-1335
Transcript Name: zgc:163098-201
Previous Names: dkey-17o15.1-001, zgc:163098-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030263 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030263|OTTDARG00000023259|ZDB-GENE-070410-141 zgc:163098|OTTDARP00000024662 DKEY-17O15.1-001 LG_ BX927261.8 Danio rerio protein_coding NOVEL, 3117 bp
AGTCGCAGAATGAAGCGTTTGGAGCTCTGATTGGTGTTTG
CCACGCGACGTCACTTTTCCGCTATTTCCATTTCTAGTGA
ATTCAAAATGGCGGATTAACAACAAACGGACTGTTTCGTT
TTTGCATCGCAAGAACTGTAGCTGACATGGCAGACAAAAA
AGGGAAATCTGTGGCGGTGAAGAGGACACTAACAAAAAAA
GAACAAGAGGAAATGAAGAAAAAGGAGGAGGAGAAAGCTG
CTGAAGTCTTTGAGGAATTTTTAGCTGCTTTTGACACTAA
TGACAAAAGTGGAGTAAAGACATTTGTACGAGGAGGTATT
GTAAATGCAACTAAAGAGGAAGAAGCCGCAGAGGTGAAGA
AGAGCAAACTCTACAGACCCTCGGCTAAATTCTCTGCTCC
ACTTCAGAATACCTCACCTGTTCACCATGCAGAAGTTAAA
AAAGCTGTTGCTAAAAAGAAAGTGGAGGAGAAGAAGAAGA
GTAATCTTGAGCTTTTTAAAGAGGAGTTAAAACAGATACA
GGAGGAAAGAGAGGAGCGATACAAAAGGAAGAAAGGCGAC
TCTGGAGCAGTTTTTTTAGGAGATCTAGAACCTCTGACAC
GAAGATCAATATTTGATGATGATCCTGCAGTGCCAAACAC
AACAAACCTTTACATCGGCTGCATCAACCCCAAGATGACA
GAGGAGATGCTGTGTAAGGAGTTTGGGAAATACGGTCCTC
TGGCCAGTGTAAAGATCATGTGGCCTCGCACTGAGGAGGA
GAGAACAAGAGTCACCAACCGTGGTTTTGTTGCTTTTATG
ACACGGAAAGATGCAGAACGTGCTCTGGCAGCGCTGGACG
GTAAAACAGTAATGGGTTTTGAGATGAAACTGGGGTGGGG
AAAGGCTGTACGCATTCCTCCTCAGCCTCTTTACACCCCC
ATCGGGGTTTTGAAGACCACTGCCCCCCCTCCACCCTCTG
GACTGCCATTTAACGCCCAACCCAGAGACCGCTTTAGAAA
TGACTTCACCAAACCACGCAGCCGCTCACAGGACGACTTT
TACAAGACTCTGTCCGAGGCCGTAGTGACAGTGGTAATCC
CCCCAGAAAGGAACCTGCTGGGCTTGATACACAGAATGAT
TGAGTTTGTGGTGAGAGAGGGACCGATGTTTGAGGCCATG
ATCATGAACCGGGAAAAGAACAACCCTGACTTCAGGTTTT
TGTTTGATAATAAGAGTCAGGAGCACGTTTACTACAGATG
GAAACTCTACTCCATTCTACAGGGTGAAAACCCAAATAAT
TGGAGAACGTCCTCTTTCAGGATGTTCAGGGGCGGCTCTC
TGTGGAAGCCCCCTCTCCTTAATCCATATCTTCACGGCGA
TGAAGAACCAGAGGAAGCATCATTCCCTTCTCCAGAGGAA
GAGCCAAAGAAAGGGCAACTGAAGTCAGAGCACAGAGAAA
AGTTGGAGGTCCTGCTGAGAGGCCTGACTCCTCGTAGAGA
TGAGATCGGTGATGCAATGCTGTTCTGCCTAGAGAGAGCA
GAGGCTGCTGAAGAGATCGTCTCCTGCATCACTGAGTCTC
TATCTATTGCACACACACCGCTGCAGAAAAAGATCGCCCG
ACTTTACCTGATATCCGACATCCTCTACAATTCCTGTGCC
AAAGTTGCTAATGCATCATATTACCGTAAATTTTTCGAGA
CAAAGCTGCCTGAGATATTTGGAGACATCAGTGAAGCGTA
TCGGAACATCCAGGCAAGACTCCAGGCAGAGCAGTTTAAG
CAAAGGATCATGGGATGTTTTCGTGCGTGGGAAGACTGGG
CAGTTTATCCAGACTCATTTCTGATCCAACTGCAGAATAT
ATTCCTAGGGCTGATCAAACCTGGAGAGGAAGTCATTGAA
AGACCAGAGCCTGAATCTCCAGATCTGGATGGAGCGCCGT
TGGATGGTGTTCCTCTAGACAGAGGTGAAATCGATGGTAC
ACCCCTCGATGACCTCGATGGGTCGCCTCTGACCTGGGAT
CCATCTGCTATAGATGGCGTACCGGTTGATGACATTGATG
GTGTTCCCTTAGGAAACTCAGTAGATGATATTGATGGTGT
GCCATTCGATGAGGGCTCTGATAAGACTTTACCCACTGTT
GCACTGTCCAAATGGGAGAAGGTGGACGATTCCGAATCCT
CAGCCAAGAATGACTCAGACAATGAGGTGAATTCAGGTGG
CCTGAAGGAGAACTCGGGTGATTCTGACACCAGCAGTGAT
GAAGCTGACAGTCCCAGCAGGTTTGAGGGGGCTGACTTTA
AGAGCTCTTTGAAAAACTTTGAACTGTCAGAAAGTAAAAG
GACACGTCTCAGAGAACTGGAGGTAAAGGTGATGAATTTC
CAGGATGAGTTAGAGTCGGGTAAGAGACAGAGAAAGTCCA
GTTTGACTCTACAACAGCAGGTTCAACACTACAGGAACAG
ACTCTTACAGAAGGAGTTTGATAAAGATGACCAGGAAAAG
AGAGACAAACATTCACAGAAACAGAAAGACCGCTCCAAAA
AAGACGAGCGGAGGGATAAAGGTGAAGAGAGGAGTAAAAC
ACGGGATAAAGAGAAAAGCAGAAAGAGTGAAGACCGAGAA
AAGAGCAGAGGACGGAGTCGAGACAAAGAAGACAGGAGAG
AGAGAACAAAATCTCGATCACCACGGAAGTCGAAGCGCTC
CCGTTCGCCATCCCCGCAGCACAAATCCTGGAGGTCTTCA
TCCCGATCGCCACATCGCTCACACAAAAAGAGCAAGAAGA
GCAAACACTGAACCCTTGAGCCTGTTAACGCTACAACGTC
TCAAACAGCCTGCGGATGGATTGTTCTCTTCATGCACAAC
CACACGTTTCCAGTCCGCCAAGCTTAGTGATTATGGACTG
GCAGATTTCCAACTGTTTCCAGAAGGCGGTTCTTCTGTCT
GTGTGGCGGCTGCAACCCGGAGTTTGGCGGAGGTTATTTT
CTAAGATGAAGTGTGAACTTGTACAGATCTTATTTTCGTT
TTGTAAACTCTTTTATTTGCGTTTTTCCCCCTTCGTTTTA
AATCCAGTGTTTAAAAAGAAATGCTGCAAGATTGACTCCA
CCGTCTTCAACTTTACAATAAAAGCAATTGTGGAAGG

zgc:163098 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:163098-201 3117
zgc:163098-203 (1)    Ensembl 812
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:163098-201 Contained in:
[BAC] DKEY-17O15 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000030263 (1),  Ensembl_Trans:ENSDART00000113642 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH464293 (1) 773 bp
GenBank:EB950596 (1) 698 bp
GenBank:EB946325 (1) 673 bp
GenBank:BI472955 (1) 610 bp
GenBank:CK679965 (1) 550 bp
GenBank:BI473225 (1) 366 bp
GenBank:EB926671 (1) 314 bp
GenBank:EH541891 (1) 231 bp
CITATIONS (2)