ZFIN ID: ZDB-TSCRIPT-141209-234
Transcript Name: vps37a-201
Previous Name: vps37a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046473 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046473|OTTDARG00000033125|ZDB-GENE-030131-8312 vps37a|OTTDARP00000036648 vps37a-001 LG_ CT573256.9 Danio rerio protein_coding KNOWN, 2002 bp
GAACGATGACGCTAGCAGCGCTAAACAGCTGACGTCATGC
TCACACGGGTTGTTTTCTTGCGAGCTCGTGTACTTCAGAC
AACAGCTTAATCTATCATACTGTCATTAAAACTCAGCGCA
TTTTAGCGTCTTTCACAGCACTTACTTTTAAGTTTCTTGT
CCGCTAATTTAAGCGGGCGTTCGGTCGCTAATACTTCTCA
AACACTACACAGGCTCGTGGCTAATGCTAATGGTGGCGTC
GGGTATTTCTTGAATTTCTGTTTCATTTCGTCAGGCCTTT
TCAAACTGACACCGCCGAAGGATTCAAGCGTTACTTAGCG
TGTTGGCAGCCGAGAATGAACTGGATTTTCCCCTTGTCCA
AGGGCTCTGGATCGATCCCTCCTCTGAACAGTTTACAGAA
ACAAAGACAGAGACAGATCGAGTCTCTCAAAGCTGCTCAC
TCCAATATTGCAGAAATCCAGAAGGATGTAGAGTACAGAC
TTCCTTTTACTGTCAACAATTCAACTATTACTGTCAATAT
CTTGCTCCCCCCACAGTTCCCTCAGGAGAAACCAGTGGTT
AGTGTTTTTCCTCCAGTGGGTCATCATTTAGTAGACGGCA
ACAATGGAACAATGGTTACCAGCCCACTCATAGCTAATTT
TGGAATGCATTCAGATTTAGGCAAAGTAATTCAGAGTTTG
CTAGATGAGTTCTGGAAAAGTCCTCCGGCCTTGACGTCAG
ATCCCACCTTTCCTTATATGTACAAACCATCGGCAATGCC
CCCTTACCCAACACAGAGCTTCCATTTTGTTCCTGCCTTC
CAACCTCAGGATGGTCAGCGGCCGATTGGCCCAGCCCCTG
TGCCACATGCAGGGATGGAGCCTCAACAAGCCCCTCCTAG
ACCAGCAGCACCAGCTTACGGACTCATCACAGACCTTCCA
CTTCCTGTACCAACTGCTGACTCACAGTCTGGCCTGAATG
GACACATATACAAGATGCCTGATATCCCAGATACATTTTC
AGAACTATCTGAGATGAGCGTTTCTCAGCTGAAGGACATG
AGCGATCAGGACGATGTGCTGTTGGACTTCTTTATGTGTC
TGCCTCAACTCAAACAAGTCACCTCAGACAAAGAGGAGCT
GGTCAACAGCATCGTAGAGATGGCCAAGAAGAACTTGCAG
CTTGAGCCACAGTTGGAGGGCAAGAGACAAGAGATGCTGT
GTAAATATGAACAGTTAACCCAGATGAAGTCGGTATTTGA
AACCAAAATGCAAAGACAACATGAGCTCAGTGAGAGCTGC
AGTTTGAGTGCGTTGCAGGCCAGATTAAAGGTAGCAGCCC
ATCAGGCTGAAGAAGAATCTGAGGAGACTGCAGAGAACTT
TCTGGAAGGAAAAACAGAGATCGACGACTTCCTAGCCAGC
TTTATGGAAAAGAGAACGCTATGTCATAGCAGAAGAGCCA
AAGAGGAGAAACTCCAGCAATGTATGAACACACACGGACA
GTTTCCCGCCACACTTTAGATTTAATATCCCAAGAAGGTT
TGGGATCAATCTACCAGCAGACCGGTGGGTTTGAGACAAG
CAGCGCATCTTGGGGTTTACAGTCTGGATTGGGCAAATAT
AAAATGCACACGACACAGATTTTGGCACCATTCTATAATG
AAATAACAATTATTTGTTTTGCACAGAATTCCTAAAAAGT
GTTACGCTCACGCTGGTTAATTAGAACAGATGTGAGCACG
GCCCACACTTGACTGTGAACCAAAGGCTGTAATCAGAAGA
GGGCGATCTGTTCTTAATAGTGTTCAGAAGCAGAAACCGA
GTTCTAAGCTTATTAGTTGTGACAAATGGGATTGGGCCTT
GTAAGCACTTGAAGATGATTCTCAACAATGTTAATGCTGC
CGTAAACGTGCGACAAAAAACATACTGTATTTAATAATGT
TGATAAAAAAAGCCTTTATTATAATTAGACATTGTATTAT
ATGTTTATTTAATTTGATAGGTTAATAAAACATTTAGAAT
AA

vps37a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA vps37a-201 2002
vps37a-202 (1) 443
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vps37a-201 Contained in:
OTHER vps37a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000046473 (1)
  • Ensembl_Trans:ENSDART00000078675 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY398348 (1) 2022bp
    GenBank:BC063954 (1) 2007bp
    GenBank:BC059584 (1) 1854bp
    GenBank:EV760473 (1) 950bp
    GenBank:CO915711 (1) 787bp
    GenBank:EE209940 (1) 519bp
    GenBank:BM184782 (1) 488bp
    CITATIONS (2)