ZFIN ID: ZDB-TSCRIPT-141209-1459
Transcript Name: vps37a-202
Previous Name: vps37a-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046474 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046474|OTTDARG00000033125|ZDB-GENE-030131-8312 vps37a|OTTDARP00000036649 vps37a-002 LG_ CT573256.9 Danio rerio protein_coding KNOWN, 443 bp
TTCTATACCGATGAACTATACCCGTCACAGAACTTTCTTT
TTGGTAACCTCCCACCTTTTATAATGTCTCTATAGTATTG
CAGAAATCCAGAAGGATGTAGAGTACAGACTTCCTTTTAC
TGTCAACAATTCAACTATTACTGTCAATATCTTGCTCCCC
CCACAGTTCCCTCAGGAGAAACCAGTGGTTAGTGTTTTTC
CTCCAGTGGGTCATCATTTAGTAGACGGCAACAATGGAAC
AATGGTTACCAGCCCACTCATAGCTAATTTTGGAATGCAT
TCAGATTTAGGCAAAGTAATTCAGAGTTTGCTAGATGAGT
TCTGGAAAAGTCCTCCGGCCTTGACGTCAGATCCCACCTT
TCCTTATATGTACAAACCATCGGCAATGCCCCCTTACCCA
ACACAGAGCTTCCATTTTGTTCCTGCCTTCCAACCTCAGG
ATG

vps37a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA vps37a-201 (1)    Ensembl 2002
vps37a-202 443
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vps37a-202 Contained in:
[BAC] CH73-218C12 (1)

Genome Resources: Vega_Trans:OTTDART00000046474 (1),  Ensembl_Trans:ENSDART00000162389 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CD583309 (1) 500 nt
GenBank:CD600517 (1) 318 nt
CITATIONS (2)