Transcript

stx3a-003

ID
ZDB-TSCRIPT-141209-2027
Name
stx3a-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060915 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060915|OTTDARG00000027947|ZDB-GENE-040426-1489 stx3a|no_translation stx3a-003 LG_ CT955967.12 Danio rerio protein_coding KNOWN, 227 bp
AGGGCAACATGGTTGATAACATTGAGGTGAATGTGGGTAA
AGCAGTCGATCACGTTGAAGCCGCAAGGGATGAAACCAAG
AAAGCAGTCAGGGTGGCATGATTGAAAGGATCGAGAACAA
CATGGACCAGTCAGTGGGTTTCGTGGAGCGAGCCGTTGCT
GACACCAAGAAAGCAGCTAAATTTCAGCAGGAGGCTCGGC
GTAAGATGATCATAGTGGGTGTGGTTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations