ZFIN ID: ZDB-TSCRIPT-141209-2027
Transcript Name: stx3a-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060915 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060915|OTTDARG00000027947|ZDB-GENE-040426-1489 stx3a|no_translation stx3a-003 LG_ CT955967.12 Danio rerio protein_coding KNOWN, 227 bp
AGGGCAACATGGTTGATAACATTGAGGTGAATGTGGGTAA
AGCAGTCGATCACGTTGAAGCCGCAAGGGATGAAACCAAG
AAAGCAGTCAGGGTGGCATGATTGAAAGGATCGAGAACAA
CATGGACCAGTCAGTGGGTTTCGTGGAGCGAGCCGTTGCT
GACACCAAGAAAGCAGCTAAATTTCAGCAGGAGGCTCGGC
GTAAGATGATCATAGTGGGTGTGGTTG

stx3a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA stx3a-201 (1)    Ensembl 2051
stx3a-203 (1)    Ensembl 1275
ncRNA stx3a-003 227
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
stx3a-003 Contained in:
[BAC] DKEY-83D4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000060915 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BG308157 (1) 235 nt
CITATIONS (1)