header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-2027
Transcript Name: stx3a-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060915 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060915|OTTDARG00000027947|ZDB-GENE-040426-1489 stx3a|no_translation stx3a-003 LG_ CT955967.12 Danio rerio protein_coding KNOWN, 227 bp
AGGGCAACATGGTTGATAACATTGAGGTGAATGTGGGTAA
AGCAGTCGATCACGTTGAAGCCGCAAGGGATGAAACCAAG
AAAGCAGTCAGGGTGGCATGATTGAAAGGATCGAGAACAA
CATGGACCAGTCAGTGGGTTTCGTGGAGCGAGCCGTTGCT
GACACCAAGAAAGCAGCTAAATTTCAGCAGGAGGCTCGGC
GTAAGATGATCATAGTGGGTGTGGTTG

stx3a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA stx3a-003 227
mRNA stx3a-201 (1) 2051
stx3a-203 (1) 1275
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
stx3a-003 Contained in:
OTHER stx3a-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000060915 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BG308157 (1) 235bp
    CITATIONS (1)