Transcript

stx3a-201

ID
ZDB-TSCRIPT-090929-18229
Name
stx3a-201
Previous Names
  • stx3a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037832 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037832|OTTDARG00000027947|ZDB-GENE-040426-1489 stx3a|OTTDARP00000030323 stx3a-001 LG_ CT955967.12 Danio rerio protein_coding KNOWN, 2051 bp
GGAGAGGGAGGAATACAGATTAAGCAGACTGAACACAACT
GTTGTTTTAATCCTCTGAGCGGATAGATTTAGATGAAAAA
AAACTACTGGTTTGGAGGAGAGCAGCCATATTGCATGGAC
CTTTGGTGGAATAACAAGACTCTGTGTCGGAGCAGGAATC
CGCGGAGTTCAGGAGCAAACATCTAGACTTCGCGAACCGC
TCCGACGCTACTTTCACCGTCTTATTGTCACATTACCTAT
TTATTATTTATTTATTTTATTTTCTGGATAGTGTTAAACA
GCAGACAGAAATATGAAGGACCGACTGGAACAACTAAAAG
CGACGTGCGATCATGATGACGAGGATGTTGAGATCGCGGT
GGACAATGCTGCTTTTATGGATGAGTTTTTTTCCCAGATT
GAAGACATTAGAAACAGCATTGATAAGATCGATGAGAATG
TGGCCGAAGTGAAAAAACTTTACTCCGTTATTCTTTCTGC
ACCAACGTCAGACCAGAAAACACAGGATGATTTGGAGGCA
TTAACTAATGATATCAAGAAAATGGCCAACAATGCTCGGA
ACAAACTGAAGACCATTGAAAGGAATCTTGAGACGGAAGA
AGTGGAAAGAGTATCGGCCGACATGAGAATACGTAAATCA
CAGCACGCTGTTCTTTCCAGAAAGTTTGTTGATGTCATGA
CCAAATACAATGAAGCTCAGGTGGACTTCAGAGAGAAGAG
CAAAGGTCGCATTCAGAGACAACTAGAGATCACCGGTAAA
GCCACAACTGATGAGGAGCTTGAGGAGATGCTGGAGGGTG
GAAACGCAGCCGTTTTTACAGCAGGGATTGTGGATTCAGG
GATCTCCAAACAAGCACTGAGCGAGATCGAAGCACGTCAC
AAAGACATTGTGCGTCTGGAGAGCAGCATAAAGGAGCTGC
ACGACATGTTTGTGGACATTGCCATGCTAGTGGAGAGCCA
GGGCAACATGGTTGATAACATTGAGGTGAATGTGGGTAAA
GCAGTCGATCACGTTGAAGCCGCAAGGGATGAAACCAAGA
AAGCAGTCAGGTATCAGAGTAAAGCCCGGAAGAAAATTAT
TATTATAGTGTCTGTGGTTTTGGTGATTTTGGCCATTATT
GCGTTGATAGTGGGTTTATCTGTAGGTCTGAAAAGATGAT
ACCGAAGATGATCATAGTGGGTGTGGTTGTTGCTGTGGTG
CTCGTCATCATCCTCATCATCATCCTCACACAGGTCTTAT
GATAACCTCTCCCTCAGCGGCTCACCATTATTACAGCTTA
TCACCTTCACTTTTCATCCTCCCTGTTTGTCCTTGGAGTT
ATGAATGGAAATGTCCGCCCCTTCACATATGGACTCTCTC
TTCATCAGAACAGACCAATGGGAAACGAGTTTCTCTTCTC
TCCTTTACATCCTCCATTTTACCTTAATGTTTTAAATGCC
CCGCCCACTCCACATATGGCTCCTCCTCTCTTCAGCACAG
ACCAATGGGAAACGAGTTCCTCTCCTTTTCATCCTCCCTG
TTTTACCTCAGGGTTTTAAATGCAAATGCCCCGCCCACTT
CACATGTGGCTCCTCCCCTCATCAGCACAGACCAATGGGA
AACAAGTCTGCTGGAACTCTAGTGATGGTCAAGAAAGTAG
ATTTTTAATATGTAATGACTGATGGGATCTGTTTAAGGAA
CCTCTACTACACGACAAGAATGCCTCTTGAAGGAAGATTA
TTTTAATGGACAAATCACAGAGCAAAGAATAAGGGATTTT
ATACGACTTGCATAGAAAGGCATCTTCCATTTCAAGCCTA
AATGTTTGTTGATGTATAGTGTGTTCATCAATAGCTGTAT
TTAGTGAAATGTTCATGATCAAAAGGGCTCAGAGATGATT
TTAGCTTCTGTTCTGGGACCTTGTGAAATGAACTTAAGCT
AAACATTGATTGGTCATCCAGAGTGGAAGAAACACACATG
TGTAGCGATTTTTTTAATAACGTAAAAGTTATGTATGGGA
GATAAAAACAGATTTAAACAAATGAATAAATAACATTTTA
TATTTTCTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations